Preparing your result...
Loading...
Press Esc to dismiss this message

Attenuated human-bovine chimeric parainfluenza virus (PIV) vaccines (15-Dec-2009)

Thumbnail
US Patent Publication (Source: USPTO)
Publication No. US 7632508 B2 published on 15-Dec-2009
Application No. US 11/324284 filed on 04-Jan-2006
Abstract (English)
Chimeric human-bovine parainfluenza viruses (PIVs) are infectious and attenuated in humans and other mammals and useful individually or in combination in vaccine formulations for eliciting an immune response to PIV or other pathogens. Also provided are isolated polynucleotide molecules and vectors incorporating a chimeric PIV genome or antigenome which includes a partial or complete human or bovine PIV “background” genome or antigenome combined or integrated with one or more heterologous gene(s) or genome segment(s) of a different PIV. Chimeric human-bovine PIV of the invention include a partial or complete “background” PIV genome or antigenome derived from or patterned after a human or bovine PIV virus combined with one or more heterologous gene(s) or genome segment(s) of a different pathogen, including different PIV virus to form the human-bovine chimeric PIV genome or antigenome.
Inventors/Applicants
Schmidt, Alexander C. [+5] [-5]
Washington, DC, US
Skiadopoulos, Mario H.
Potomac, MD, US
Collins, Peter L.
Rockville, MD, US
Murphy, Brian R.
Bethesda, MD, US
Bailly, Jane E.
Quebec, CA
Durbin, Anna P.
Takoma Park, MD, US
Assignees
The United States of America
Washington, DC, US
Classifications
International (2006.01): A61K 39/12; A61K 39/155
National: 424/199.1; 424/211.1
Field of Search: Non/e
Patent References
US 4683195 A Process for amplifying, detecting, and/or-cloning nucleic acid sequences Jul-1987
US 4683202 A Process for amplifying nucleic acid sequences Jul-1987
US 5716821 A Prevention and treatment of respiratory tract disease Feb-1998 [+29] [-29]
US 5789229 A Stranded RNA virus particles Aug-1998
US 5869036 A Live attenuated vaccines based on CP45 HPIV-3 strain and method to ensure attenuation in such vaccine Feb-1999
US 6033886 A Recombinant infectious non-segmented negative strand RNA virus Mar-2000
US 6264957 B1 Product of infectious respiratory syncytial virus from cloned nucleotide sequences Jul-2001
US 6764685 B1 Recombinant parainfluenza virus expression systems and vaccines Jul-2004 424/211.1
US 7192593 B2 Use of recombinant parainfluenza viruses (PIVs) as vectors to protect against infection and disease caused by PIV and other human pathogens Mar-2007 424/199.1
US 7201907 B1 Attenuated human-bovine chimeric parainfluenza virus(PIV) vaccines Apr-2007 424/199.1
US 7250171 B1 Construction and use of recombinant parainfluenza viruses expressing a chimeric glycoprotein Jul-2007 424/211.1
US 2003/0082209 A1 Attenuated human-bovine chimeric parainfluenza virus (PIV) vaccines May-2003 424/210.1
EP 0440219 A1 cDNA corresponding to the genome of negative-strand RNA viruses, and process for the production of infectious negative-strand RNA viruses Aug-1991
EP 0702085 A1 Recombinant infectious non-segmented negative strand RNA virus Mar-1996
WO 92/01471 Feb-1992
WO 93/14207 Jul-1993
WO 93/21310 Oct-1993
WO 97/06270 Feb-1997
WO 97/11093 Mar-1997
WO 97/12032 Apr-1997
WO 97/20468 Jun-1997
WO 98/02530 Jan-1998
WO 98/43668 Oct-1998
WO 98/53078 Nov-1998
WO 99/02657 Jan-1999
WO 99/15631 Apr-1999
WO 99/24564 May-1999
WO 00/61611 Oct-2000
WO 00/61737 Oct-2000
WO 01/04271 Jan-2001
WO 01/04321 Jan-2001
WO 01/04335 Jan-2001
Other References
Bailly et al., “A Recombinant Human Parainfluenza Virus Type 3 (PIV3) In Which the Nucleocapsid N Protein Has Been Replaced”, Journal Virology, vol. 74, No. 7, 3188-3195 (2000). [+171] [-171]
Baron et al., “Rescue of Rinderpest Virus From Cloned Cdna”, Journal Virology, vol. 71, No. 2, 1265-1271 (1997).
Bellini et al., “Measles Virus P Gene Codes for Two Proteins”, Journal Virology, vol. 53, No. 3, 908-919 (1985).
Belshe et al., “Cold Adaptation of Parainfluenza Virus Type 3”, Journal Medical Virology, vol. 10(4), 235-242 (1982).
Belshe et al., “Comparison of Enzyme-Linked Immunosorbent Assay and Neutralization Techniques for Measurement of Antibody”, Infect And Immun. vol. 37, 160-165 (1982).
Blumberg et al., “Measles Virus L Protein Evidences Elements of Ancestral RNA Polymerase,” Virology, 164:487-497, 1988.
Buchholz et al., “Chimeric Bovine Respiratory Syncytial Virus With Glycoprotein Gene Substitutions,” Journal Virology, vol. 74, No. 3, 1187-1199 (2000).
Buchholz et al., “Generation of Bovine Respiratory Syncytial Virus (BRSV) from cDNA,” Journal Virology, vol. 73, No. 1, 251-259 (1999).
Bukreyev et al., “Recombinant Respiratory Syncytial virus from which the Entire SH Gene has been Deleted Grows Efficiently in Cell Culture and Exhibits Site-Specific Attenuation in the Respiratory Tract of the Mouse,” J. Virol. 71:8973-8982, 1977.
Bukreyev et al., “Interferon Gamma Expressed By A Recombinant Respiratory Syncytial Virus Attenuates Virus Replication In Mice,” Proc. Natl. Acad. Sci. USA, vol. 96, 2367-2372 (1999).
Bukreyev et al., “Recovery of Infectious Respiratory Syncytial Virus Expressing An Additional, Foreign Gene,” Journal Virology, vol. 70, No. 10, 6634-6641 (1996).
Cadd et al., “The Sendai Paramyxiovirus Accessory C Proteins Inhibit Viral Genome Amplification in Promoter-Specific Fashion,” J. Virol 70: 5067-74, 1996.
Cahour et al., “Growth-Restricted Dengue Virus Mutants Containing Deletions in the 5 Noncoding Region of the RNA Genome,” Virology, vol. 207, 68-76 (1995).
Cattaneo et al., “Measles Virus Editing Provides Additional Cytosine-Rich Protein,” Cell, vol. 56, 759-764, (1989).
Cheng et al., “Effective Amplification of Long Targets From Cloned Inserts,” Proc. Natl. Acad. Sci. USA, vol. 91, 5695-5699 (1994).
Clarke et al., “Rescue of Mumps Virus From cDNA,” J Virology, vol. 74, No. 10, 4831-4838 (2000).
Clements et al., “Comparison of Virologic—Immunologic Resp. of Volunteers To Live Avian-Human Influenza A H3N2 Reassortant,” Journal Clinical Microbiology, vol. 27, No. 1, 219-222 (1989).
Clements et al., “Evaluation of Bovine Cold-Adapted Human, and Wild Type Human Parainfluenza Type 3 Viruses in Adult Volunteers,” J. Clinical Microbiology, vol. 29, 1175-1182 (1991).
Clements et al., “Use of Single-Gene Reassortant Viruses to Study Role of Anain Influenza A Virus,” Journal Clinical Microbiology, vol. 30, No. 3, 655-662 (1992).
Clements-Mann et al., “Safety and Immunogenicity of Live Attenuated Human-Bovine (UK) Reassortant Rotavirus Vaccines VP7 Specificity,” Vaccine vol. 17, 2715-2725 (1999).
Collins et al., “Parainfluenza Viruses,” Fields Virology 3rd ed., Lippincott-Raven Publishers, Philadelphia 1205-1241, (1996).
Collins et al., “Rescue of a 7502-Nucleotide (49.3% of Full-Length) Synthetic Analog of Respiratory Syncytial Virus Genomic RNA,” Virology 195:252-256, 1993.
Collins et al., “Rescue of Synthetic Analogs of Respiratory Syncytial Virus Genomic RNA and Effect of Truncations and Mutations on the Expression of a Foreign Reporter Gene,” Proc. Natl. Acad. Sci. USA, 88:9663-9667, 1991.
Collins et al., “Production of Infectious Human Respiratory Syncytial Virus From Cloned cDNA,” Pro. Natl. Acad. Sci., vol. 92, 11563-11567 (1995).
Connors et al., “A Cold-Passaged Attenuated Strain of Human Respiratory Syncytial Virus Contains Mutations in the F and L Genes,” Virology 208:478-484, 1995.
Conzelmann et al., “Rescue of Synthetic Genomic RNA Analogs of Rabies Virus by Plasmid-Encoded Proteins,” J. Virol. 68: 713-719, 1994.
Conzelmann et al., “Genetic Manipulation of Non-Segmented Negative-Strand RNA Viruses,” Journal General Virology, vol. 77, 381-389 (1996).
Cook et al., “Antigenic Relationships Among the “Newer” Myxoviruses (Parainfluenza),” Amer. Jour. Hyq. 69:250, 1959.
Cook et al., “In Vivo Antigenic Studies of Parainfluenza Viruses,” American Journal of Hygiene, vol. 77, 150-159 (1962).
Corsoro and Pearson, “Enhancing the Efficiency of DNA Mediated Gene Transfer In Mammalian Cells,” Somatic Cell Genetics, vol. 7, No. 5, 603-616 (1981).
Crookshanks et al., “Evaluation of Cold-Adapted And Temperature-Sensitive Mutants Of Parainfluenza Virus Type 3,” Journal Medical Virology, vol. 13, 243-249 (1984).
Crowe et al., “A Further Attenuated Derivative of a Cold-Passaged Temperature-Sensitive Mutant of Human Respiratory Syncytial Virus Retains Immunogenicity and Protective Efficacy Against Wild-Type Challenge in Seronegative Chimpanzees,” Vaccine 12:783-790, 1994.
Crowe et al., “Acquisition of the ts Phenotype by a Chemically Mutagenized Cold-Passaged Human Respiratory Syncytial Virus Vaccine Candidate Results from the Acquisition of a Single Mutation in the Polymerase (L) Gene,” Virus Genes 13: 269-273, 1996.
Crowe et al., “Cold-Passaged, Temperature-Sensitive Mutants of Human Respiratory Syncytial Virus (RSV),” Vaccine, vol. 13, No. 9, 847-855 (1995).
Curran et al., “The Sendai Virus Nonstructural C Proteins Specifically Inhibit Viral mRNA Synthesis,” Virology 189: 647-656, 1992.
Curran et al., “Sendai Virus P Gene Produces Multiple Proteins From Overlapping Open Reading Frames, Enzyme,” vol. 44, 244-249 (1990).
Delenda et al., “Normal Cellular Replication of Sendai Virus Without Trans-Frame, Nonstructural V Protein,” Virology, vol. 228, 55-62 (1997).
Delenda et al., “Sendai Viruses With Altered P, V, and W Protein Expression,” Virology, vol. 242, 327-337 (1998).
Deng et al, “Localization of a Domain on the Paramyxovirus Attachment Protein Required for the Promotion of Cellular Fusion,” Virology, vol. 209, 457-469 (1995).
Dimock et al., “Rescue of Synthetic analogs of Genomic RNA and Replicative-Intermediate RNA of Human Parainfluenza Virus Type 3,” Journal Virology, vol. 67, No. 5, 2772-2778 (1993).
Durbin et al., “Mini. Protein Requirements for Transcription, RNA Replication of Minigenome of Human Parainfluenza Virus Type 3 and Evaluation of the Rule of Six,” Virology, vol. 234, 74-83 (1997).
Durbin et al., “Mutations In C, D, and V Open Reading Frames of Human Parainfluenza Virus Type 3 Attenuate Replication In Rodents and Primates,” Virology, vol. 261, 319-330 (1999).
Durbin et al., “Recovery of Infections Human Parainfluenza Virus Type 3 from cDNA,” Virology, vol. 235, 323-332 (1997).
Emerson et al., “A Simian Strain of Hepatitis A Virus, AGM-27, Functions As An Attenuated Vaccine for Chimpanzees,” Journal Infectious Diseases, vol. 173, 592-597 (1996).
Escoffier et al., “Nonstructural C Protein is Required for Efficient Measles Virus Replication in Human Peripheral Blood Cells,” J Virol. 73:1695-8, 1999.
Finke et al. “Ambisense Gene Expression for Recombinant Rabies Virus: Random Packaging of Positive- and Negative-Strand Ribonucleoprotein Complexes into Rabies Virions,” J. Virol. 71:7281-7288, 1997.
Firestone et al., “Nucleotide Sequence Analysis of the Respiratory Syncytial Virus Subgroup A Cold-Passaged (cp) Temperature Sensitive (ts) cpts-248/404 Live Attenuated Virus Vaccine Candidate,” Virology 225:419-422, 1996.
Flexner et al., “Prevention of vaccinia virus infection in immunodeficient mice by vector-directed IL-2 expression,” Nature 33:259-262,1987.
Frank et al. “Comparison of Different Tissue Cultures for Isolation and Quantitation of Influenza and Parainfluenza Viruses,” J. Clin. Microbiol. 10:32-6(1979).
Fuerst et al., “Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase,” Proc. Natl. Acad. Sci. USA 83:8122-8126, 1986.
Galinski et al., “Molecular Cloning and Sequence Analysis of Human Parainfluenza 3 Virus mRNA Encoding the P and C Proteins,” Virology 155:46-60, 1986.
Galinski et al., “Molecular Cloning and Sequence Analysis of Human Parainfluenza 3 Virus mRNA Encoding the L Protein,” Virology 165:499-510, 1988.
Galinski et al., “RNA Editing in the Phosphoprotein Gene of the Human Parainfluenza Virus Type 3,” Virology 186:543-550, 1992.
Galinski, “Annotated Nucleotide and Protein Sequences for Selected Paramyxoviridae,” In The Paramyxoviruses, Kingsbury D.W., Ed., 537-568, Plenum Press, New York, 1991.
Garcin et al., “A Point Mutation in the Sendai Virus Accessory C Proteins Attenuates Virulence for Mice, but Not Virus Growth in Cell Culture,” Virology 238:424-431, 1997.
Garcin et al., “A Highly Recombinogenic System For Recovery of Infectious Sendai Paramyxovirus For cDNA,” EMBO Journal, vol. 14, No. 24, 6087-6094 (1995).
Graham et al., “A New Technique for The Assay of Infectivity of Human Adenovirus 5 DNA, Virology,” vol. 52, 456-467 (1973).
Gromeier et al., “Dual Stem Loops within the Poliovirus Internal Ribosomal Entry Site Control Neurovirulence,” Journal of Virology, vol. 73, No. 2, 958-964 (1999).
Grosfeld et al., “RNA Replication By Respiratory Syncytial Virus (RSV) Is Directed By N, P, and L Proteins,” Journal of Virology, vol. 69, No. 9, 5677-5686 (1995).
Haas et al., “Codon Usage Limitation In The Expression Of HIV-1 Envelope Glycoprotein,” Current Biology, vol. 6, No. 3, 315-324 (1996).
Hall et al., “Cold Passaged Human Parainfluenza Type 3 Viruses Contain ts and Non ts Mutations Leading To Attenuation In Rhesus Monkeys,” Virus Research, vol. 22, 173-184 (1992).
Hasan et al., “Creation of an Infectious Recombinant Sendai Virus Expressing the Firefly Luciferase Gene from the 3′ Proximal First Locus,” J. Gen. Virol. 78:2813-20, 1997.
Hawley-Nelson et al., “A New Higher Efficiency Polyatomic Liposome Transfection Reagent,” Focus, vol. 15, No. 3, 73-79 (1993).
He et al., “Recovery of Infectious SV5 From Cloned DNA and Expression of A Foreign Gene,” Virology, vol. 237, 249-260 (1997).
He et al., “The Paramyxovirus SV5 Small Hydrophobic (SH) Protein Is Not Essential For virus Growth In Tissue Culture Cells,” Virol. vol. 250 30-40 (1998).
Heikkinen et al., “Prevalence of Various Respiratory Viruses In The Middle Ear During Acute Ottitis Media,” New England Journal of Medicine, vol. 340, 260-264 (1999).
Hoffman et al., “An Infectious Clone of Human Parainfluenza Virus Type 3,” Journal Virology, vol. 71, No. 6, 4272-4277 (1997).
Hurwitz et al., “Intranasal Sendai Virus Vaccine Protects African Green Monkeys From Infection With Human Parainfluenza Virus Type One,” Vaccine, vol. 15, No. 5, 533-540 (1997).
Itoh et al., “Isolation of an Avirulent Mutant of Sendai Virus with Two Amino Acid Mutations from a Highly Virulent Field Strain Through Adaptation to LLC-MK2 Cells,” J. Gen Virol. 78:3207-3215, 1997.
Jin et al., “Recombinant Human Respiratory Syncytial Virus (RSV) from cDNA and Construction of Subgroup A and B Chimeric RSV,” Virology, vol. 251, 206-214 (1998).
Johnson et al., “Specific Targeting to CD4+ Cells of Recombinant Vesicular Stomatitis Viruses Encoding Human Immunodeficiency Virus Envelope Proteins,” J. Virol. 71:5060-5068, 1997.
Juhasz et al., “The Temperature-Sensitive (ts) Phenotype of a Cold-Passaged (cp) Live Attenuated Respiratory Syncytial Virus,” Journal of Virology, vol. 71, No. 8, 5814-5819 (1997).
Kahn et al., “Recombinant Vesicular Stomatitis Virus Expressing Respiratory Syncytial Virus (RSV) Glycoproteins: RSV Fusion Protein Can Mediate Infection and Cell Fusion,” Virology 254:81-91, 1999.
Kapikian et al., “Update On Jennerian And Modified Jennerian Approach To Vaccination Of Infants And Young Children . . . ,” Genetically Engineered Vaccines, vol. 327, 59-69 (1992).
Karron et al., “A Live Human Parainfluenza Type 3 Virus Vaccine is Attenuated and Immunogenic in Healthy Infants and Children,” J. Inf. Dis. 172:1445-1450, 1995b.-yes.
Karron et al., “A. Live Attenuated Bovine Parainfluenza Virus Type 3 Vaccine Is Safe, Infectious, Immunogenic, and Phenotypically Stable In Infants And Children,” Journal of Infectious Diseases, vol. 171, 1107-1104 (1995).
Karron et al., “Evaluation of a Live Attenuated Bovine Parainfluenza Type 3 Vaccine In Two To Six Month Old Infants,” Pediatric Infectious Diseases Journal, vol. 15, 650-654 (1996).
Kast et al., “Protection against lethal Sendai virus infection by in vivo priming of virus-specific cytotoxic T lymphocytes with a free synthetic peptide,” Proc. Natl. Acad.Sci.USA 88:2283-2287,1991.
Kato et al., “Importance of Cysteine Rich Carboxyl Terminal Half of V Protein for Sendai Virus Pathogenesis,” Journal Virology, vol. 71, No. 10, 7266-7272 (1997).
Kato et al., “Initiation of Sendai Virus Multiplication From Transfected cDNA or RNA with Negative or Positive Sense,” Genes To Cells, vol. 1, 569-579 (1996).
Kato et al., “The Paramyxovirus Sendai Virus V Protein Encodes A Luxury Function Required For Viral Pathogenesis,” EMBO Journal, vol. 16, No. 3, 578-587 (1997).
Kozak et al, “At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells,” Journal Molecular Biology, vol. 196, 947-950 (1987).
Kretzschmar et al., “Normal Replication of Vesicular Stomatitis Virus Without C Proteins,” Virology, vol. 216, 309-316 (1996).
Kunkel et al., “Rapid and Efficient Site-Specific Mutagenesis Without Phenotypic Selection,” Proc. Natl. Acad. Sci., vol. 82, 488-492 (1985).
Kuo et al., “Effect of Mutations in the Gene-Start and Gene-End Sequence Motifs on Transcription of Monocistronic and Dicistronic Minigenomes of Respiratory Syncytial Virus,” J. Virol. 70:6892-6901, 1996.
Kurotani et al., “Sendai Virus C Proteins are Categorically Nonessential Gene Products but Silencing Their Expression Severely Impairs Viral Replication and Pathogenesis,” Genes to Cells 3:111-124, 1998.
Lamb et al., “In The Paramyxoviruses,” D. Kingsbury, ed., 181-214, Plenum Press, New York, 1991.
Latorre et al., The Various Sendai Virus C Proteins are Not Functionally Equivalent and Exert both Positive and Negative Effects on Viral FNA Accumulation During the Course of Infection, J. Virol. 72:5984-5993, 1998.
Lawson et al., “Recombinant Vesicular Stomatitis Viruses From DNA,” Proc. Natl. Acad. Sci., vol. 92, 4477-4481 (1995).
Liston et al., “Ribosomal Frameshifting During Translation of Measles Virus P Protein mRNA Is Capable of Directing Synthesis,” Journal Virology, vol. 69, No. 11, 6742-6750 (1995).
Mallipeddi et al., “Sequence Comparison Between the Phosphoprotein mRNAs of Human and Bovine Respiratory Syncytial Viruses Identifies a Divergent Domain in the Predicted Protein,” J. Gen. Virol. 73:2441-2444, 1992.
Mallipeddi et al., “Sequence Variability of the Glycoprotein Gene of Bovine Respiratory Syncytial Virus,” J. Gen. Virol. 74:2001-2004, 1993.
Marx et al., “Pediatric Hospitalizations for Croup,” Journal Infectious Diseases, vol. 176, 1423-1427 (1997).
Matsuoka et al., “The P Gene of Human Parainfluenza Virus Type 1 Encodes P and C Proteins But Not a Cysteine Rich V Protein,” Journal Virology, vol. 65, No. 6, 3406-3410 (1991).
Mebatsion et al., “Highly Stable Expression of a Foreign Gene from Rabies Virus Vectors,” Proc. Natl. Acad. Sci. U S A 93:7310-7314,1996.
Men et al., “Dengue Type 4 Virus Mutants Containing Deletions in the 3 Noncoding Region of the RNA,” Journal of Virology, vol. 70, No. 6, 3930-3937 (1996).
Mink et al., “Nucleotide Sequences of the 3′ Leader and 5′ Trailer Regions of Human Respiratory Syncytial Virus Genomic RNA,” Virology 185:615-624, 1991.
Moriya et al., “Large Quantity Production with Extreme Convenience of Human SDF-Ia by a Sendai Virus Vector,” FEBS Lett. 425:105-111, 1998.
Murphy et al., “Enhanced pulmonary histopathology is observed in cotton rats immunized with formalin-inactivated respiratory syncytial virus (RSV) or purified F glycoprotein and challenged with RSV 3-6 months after immunization,” Vaccine 8(5):497-502, 1990.
Murphy et al., “Failure of Attenuated Temperature-Sensitive Influenza A (H3N2) Virus to Induce Heterologous Interference in Humans to Parainfluenza Type 1 Virus,” Infect.Immun.12:62-8,1975.
Murphy et al., “Current Approaches to the Development of Vaccines Effective Against Parainfluenza,” Virus Research, vol. 11, 1-15 (1988).
Murphy et al., “Dose Response of Influenza A Washington 897 80 (H3N2) Avian-Human Reassortant Virus In Adult Volunteers,” Journal Infectious Diseases, vol. 152, No. 1, 225-229 (1985).
Muster et al., “An Influenza A Virus Containing Influenza B Virus 5 and 3 Noncoding Regions on the Neuraminidase Gene Is Attenuated In Mice,” Proc. Natl. Acad. Sci., vol. 88, 5177-5181 (1991).
Needleman and Wunsch, “A General Method Applicable To The Search For Similarities In The Amino Acid Sequence Of Two Proteins,” Journal of Molecular Biology, vol. 48 (1970).
Neumann et al., “Gene Transfer Into Mouse Lymoa Cells By Electroporation In High Electric Fields,” EMBO J. vol. 1, No. 7, 841-845 (1982).
Palese et al., “Negative Strand RNA Viruses Genetic Engineering and Applications,” Proc. Natl. Acad. Sci., vol. 93, 11354-11358 (1996).
Park et al., “In Vivo Model for Pseudo-Templated Transcription in Sendai Virus,” Journal Virology, vol. 66, No. 12, 7033-7039 (1992).
Pastey et al., “Nucleotide Sequence Analysis of the Non-Structural NS1(1C) and NS2 (1B) Protein Genes of Bovine Respiratory Syncytial Virus,” J. of Gen. Virol. 76:193-197, 1995.
Pastey et al., “Structure and Sequence Comparison of Bovine Respiratory Syncytial Virus Fusion Protein,” Virus Res. 29: 195-202, 1993.
Pearson et al., “Improved Tools For Biological Sequence Comparison,” Proc. Natl. Acad. Sci. USA, vol. 85, 2444-2448 (1988).
Peeters et al., “Rescue of Newcastle Disease Virus From Cloned cDNA . . . ,” Journal of Virology, vol. 73 (1999).
Pelet et al., “The P Gene of Bovine Parainfluenza Virus 3 Expresses All Three Reading Frames from A Single MRNA Edition Site,” EMBO Journal, vol. 10, No. 2, 443-448 (1991).
Perez-Schael et al., “Efficacy of Rhesus Rotavirus Based Quadrivalent Vaccine In Infants and Young Children In Venezuela,” New England of Journal Medicine, vol. 337, No. 17, 1181-1187 (1997).
Perrotta et al., “A Pseudoknot-Like Structure Required For Efficient Self-Cleavage Of Hepatitis Delta Virus RNA,” Nature, vol. 350, 434-436 (1991).
Radecke (Radicle) et al., “The Nonstructural C Protein Is Not Essential For Multiplication of Edmonston B Strain Measles Virus In Cultured Cells,” Virology, vol. 217, 418-421 (1996).
Radecke et al., “Rescue of Measles Viruses from Cloned DNA,” EMBO Journal, vol. 14, 5773-5784 (1995).
Randhawa et al., “Nucleotide Sequences of Genes Encoding the Putative Attachment Glycoprotein (G) of Mouse and Tissue Culture Passaged Strains of Pneumonia,” Virology, vol. 207 240-245 (1995).
Ray et al., “Temperature-Sensitive Phenotype of Human Parainfluenza Virus Type 3 Candidate Vaccine Strain (cp45) Correlates with a Defect in the L Gene,” J. Virol. 70:580-584, 1996.
Ray et al., “Human Parainfluenza Virus Induces A Type Specific Protective Immune Response, Journal Infectious Diseases,” vol. 162, 746-749 (1990).
Roberts et al., “Recovery of Negative Strand RNA Viruses From Plasmid DNAs,” Virology 247, 1-6 (1998).
Roberts et al., “Attenuated Vesicular Stomatitis Viruses as Vaccine Vectors,” J. Virol. 73:3723-3732, 1999.
Roberts et al., “Vaccination with a Recombinant Vesicular Stomatitis Virus Expressing an Influenza Virus Hamagglutinin Provides Complete Protection from Influenza Virus Challenge,” J. Virol. 72:4704-4711, 1998.
Sakaguchi et al., “Expression of the HN, F, NP and M Proteins of Sendai Virus by Recombinant Vaccinia Viruses and Their Contribution to Protective Immunity Against Sendai Virus Infections in Mice,” J. Gen. Virol. 74:479-484, 1993.
Sakai et al., “Accommodation of Foreign Genes into the Sendai Virus Genome: Sizes of Inserted Genes and Viral Replication,” FEBS Letters 456:221-226, 1999.
Sanchez et al., “Cloning and Gene Assignment of mRNAs of Human Parainfluenza Virus 3,” Virology, vol. 147, 177-186 (1985).
Schnell et al., “Foreign Glycoproteins Expressed from Recombinant Vesicular Stomatitis Viruses are Incorporated Efficiently into Virus Particles,” Proc. Natl. Acad. Sci. USA 93:11359-11365, 1996.
Schneider et al., “Recombinant Measles Viruses Defective for RNA Editing,” Virology, vol. 227, 314-322 (1997).
Schnell et al., “Construction of a Novel Virus that Targets HIV-1-Infected Cells and Controls HIV-1 Infection,” Cell 90:849-857, 1997.
Schnell et al., “The Minimal Conserved Transcription Stop-Start Signal Promotes Stable Expression of a Foreign Gene in Vesicular Stomatitis Virus,” J. Virol. 70:2318-2323, 1996.
Schnell et al., “Infectious Rabies Viruses from Cloned cDNA,” EMBO Journal, vol. 13, No. 18, 4195-4203 (1994).
Singh et al., “A Recombinant Measles Virus Expressing Biologically Active Human Interleukin-12,” J. Gen. Virol. 80:101-106, 1999.
Singh et al., “A Recombinant Measles Virus expressing Hepatitis B Virus Surface Antigen Induces Humoral Immune Responses in Genetically Modified Mice,” J. Virol. 73:4823-4828, 1999.
Skiadopoulos et al., “Generation of Parainfluenza Virus Type 1 Vaccine Candidate By Replacing HN and F Glycoproteins . . . ,” Vaccine, vol. 18, 503-510 (1999).
Skiadopoulos et al., “Identification of Mutations Contributing to Temperature Sensitive Cold Adapted . . . ,” Journal Virology, vol. 73, No. 2, 1374-1381 (1999).
Skiadopoulos et al., “Three Amino Acid Substitutions in L Protein of Human Parainfluenza Virus Type 3 cp45 Live Attenuated Vaccine . . . ,” Journal Virology, vol. 72, No. 3, 1762-1768 (1998).
Smith & Waterman, “Comparison of Biosequences,” Advanced Applied Mathematics, vol. 2, 482-489 (1981).
Snyder et al., “Evaluation of Live Avian Human Reassortant Influenza A H2N2 and H1N1 Virus Vaccines,” Journal Clinical Micro., vol, 23, No. 5, 852-857 (1986).
Spielhofer et al., “Chimeric Measles Viruses with a Foreign Envelope,” J. Virol. 72:2150-2159, 1998.
Sprent et al., “Generalization Of The Sign Test, Applied Nonparametric Statistical Method,” 123-126, Chapman and Hall, London, 1989.
Spriggs et al., “Sequence Analysis of P and C Protein Genes of Human Parainfluenza Virus Type 3,” Journal General Virology, vol. 67, 2705-2719 (1986).
Steinhoff et al., “A Mallard 6750 78 Avian Human By Not A Ann Arbor 6 60 Cold Adapted Influenza,” Journal Infectious Diseases, vol. 163, 1023-1028 (1991).
Stokes et al., “The Complete Nucleotide Sequence of Two Cold-Adapted, Temperature-Sensitive Attenuated Mutant Vaccine Viruses (cp12 and cp45) Derived from the JS Strain and Human Parainfluenza Virus Type 3 (PIV3),” Virus Res. 30:43-52, 1993.
Stokes et al., “The Complete Nucleotide Sequence of JS Strain of Human Parainfluenza Virus Type 3,” Virus Research, vol. 25, 91-103 (1992).
Suzu et al., “Nucleotide Sequence of Bovine Parainfluenza 3 Virus Genome, Nucleic Acids Research,” vol. 15, No. 7, 2945-2958 (1987).
Tanabayashi et al., “Functional Interaction of Paramyxovirus Glycoproteins,” Journal Virology, vol. 70, No. 9, 6112-6118 (1996).
Tao et al., “A Live Attenuated Chimeric Recombinant Parainfluenza Virus (PIV) Encoding the Internal Proteins of PIV Type 3 . . . ,” Vaccine, vol. 17, 1100-1108 (1999).
Tao et al., “Recovery of A Fully Viable Chimeric Human Parainfluenza Virus (PIV) Type 3 . . . ,” Journal Virology, vol. 72, No. 4, 2955-2961 (1998).
Teng et al., “Altered Growth Characteristics of Recombinant Respiratory Syncytial Viruses,” Journal Virology, vol. 73, No. 1, 466-473 (1999).
Teng et al., “Identification of Respiratory Syncytial virus Proteins Required for Formation and Passage,” Journal Virology, vol. 72, No. 7, 5707-5716 (1998).
Thomas et al., “Two mRNAs That Differ by Two Nontemplated Nucleotides,” Cell, vol. 54, 891-902 (1988).
Thomson et al., “Recombinant Polyepitope Vaccines for the Delivery of Multiple CD8 Cytotoxic T Cell Epitopes,” J. Immunol.157:822,1996.
Valsamakis et al., “Recombinant Measles Viruses with Mutations in the C, V, or F Gene Have Altered Growth Phenotypes In Vivo,” Journal Virology, vol. 72, No. 10, 7754-7761 (1998).
van Wyke Coelingh et al., “Antigenic Variation in the Hemagglutinin-Neuraminidase Protein of Human Parainfluenza Type 3 Virus,” Virology 143(2):569-582,1985.
Van Wyke Coelingh et al., “Antigenic and Structural Properties of Hemagglutinin-Neuraminidase Glycoprotein of Human Parainfluenza Virus Type 3: Sequence Analysis of Variants Selected with Monoclonal Antibodies which Inhibit Infectivity, Hemagglutination, and Neuraminidase Activities,” J. Virol. 61:1473-1477, 1987.
van Wyke Coelingh et al., “Antibody Responses of Humans and Nonhuman Primates to Individual Antigenic Sites,” Journal Virology, vol. 64, No. 8, 3833-3843 (1990).
Van Wyke Coelingh et al., “Attenuation of Bovine Parainfluenza Virus Type 3 in Nonhuman Primates, Journal Infectious Diseases,” vol. 157, No. 4, 655-662 (1988).
van Wyke Coelingh et al., “Conserved Epitopes On Hemagglutinin-Neuraminidase Proteins of Human and Bovine Parainfluenza Type 3 Viruses,” Journal Virology, vol. 60, No. 1, 90-96 (1986).
Vidal et al., “Editing of Sendai Virus PC mRNA by G Insertion Occurs During mRNA Synthesis Via A Virus Encoded Activity,” Journal Virology, vol. 64, No. 1, 239-246 (1990).
Wathen et al., “Characterization of a Novel Human Respiratory Syncytial Virus Chimeric FG Glycoprotein Expressed Using a Baculovirus Vector,” J. Gen. Virol. 70:2625-2635, 1989.
Whelan et al., “Efficient Recovery of Infectious Vesicular Stomatitis Virus Entirely from cDNA Clones,” Proc. Natl. Acad. Sci., vol. 92, 8388-8392 (1995).
Whitehead et al., “A Single Nucleotide Substitution In Transcription Start Signal of M2 Gene . . . ,” Virology, vol. 247, 232-239 (1998).
Whitehead et al., “Recombinant Respiratory Syncytial Virus (RSV) Bearing A Set of Mutations . . . ,” Journal Virology, vol. 72, No. 5, 4467-4471 (1998).
Whitehead et al., “Recombinant Respiratory Syncytial Virus Bearing A Deletion of Either the NS2 or SG Gene . . . ,” Journal Virology, vol. 73, No. 4, 3438-3442 (1999).
Wigler et al., “Biochemical Transfer of Single Copy Eukaryotic Genes Using Total Cellular DNA As Donor,” Cell, vol. 14, 725-731 (1978).
Wyatt et al., “Replication Deficient Vaccinia Virus Encoding Bacteriophage T7 RNA, Virology,” vol. 210, 202-205 (1995).
Yu et al., “Sendai Virus-Based Expression of HIV-1 gp 120: Reinforcement by the V(−) Version,” Genes to Cells 2:457-466, 1997.
Zamora et al., “Gene Junction Sequences of Bovine Respiratory Syncytial Virus,” Virus Res. 24:115-121, 1992.
Zamora et al., “Sequence Analysis of M2 mRNA of Bovine Respiratory Syncytial Virus Obtained from an F-M2 Dicistronic mRNA Suggests Structural Homology with that of Human Respiratory Syncytial Virus,” J. Gen Virol. 73:737-741, 1992.
Zimmerman et al., “The Poly(C) Region Affects Progression of Encephalomyocarditis Virus,” Journal Virology, vol. 71, No. 5, 4145-4149 (1997).
Crowe et al, “Current Approaches to the Development of Vaccines Against Disease Caused by Respiratory Syncytial Virus,” Vaccine vol. 13 No. 4 415-421 (1995).
Kunkel et al., “Rapid and Efficient Site-Specific Mutagenesis Without Phenotypic Selection,” Methods Enzynnol. vol. 154 367-383 (1987).
Kretzschmar et al., “High-Efficiency lncorporaion of Functional Influenza Virus Glycoproteins into Recombinant Vesicular Stomatitis Viruses,” J. Virol. vol. 71, pp. 5982-5989 (1997).
Prior Publications
Related Documents
Continuation of application No. US 11/78658 00, filed on 11-Mar-2005, now abandoned, which is a continuation of application No. US 10/915634 00, filed on 10-Aug-2004, now abandoned, which is a continuation of application No. US 10/30544 00, filed as application No. PCT/US00/17066 on 15-Jun-2000, now abandoned (continued). [+5] [-5]
Continuation-in-part of application No. US 09/458813 00, filed on 10-Dec-1999, now Pat. No. US 7314631 A, which is a continuation-in-part of application No. US 09/83793 00, filed on 22-May-1998, now Pat. No. US 7208161 A, which is a continuation-in-part of application No. US 11/324284 00.
Continuation-in-part of application No. US 09/586479 00, filed on 01-Jun-2000, now Pat. No. US 7201907 A, which is a continuation-in-part of application No. US 09/459062 00, filed on 10-Dec-1999, now Pat. No. US 7250171 A.
Provisional application No. US 60/143134 00, filed on 09-Jul-1999.
Provisional application No. US 60/47575 00, filed on 23-May-1997.
Provisional application No. US 60/59385 00, filed on 19-Sep-1997.
Examiners
Primary: Chen, Stacy B
Attorney, Agent or Firm
Woodcock Washburn LLP

Supplemental Information (Source: DOCDB)
Inventors
SCHMIDT ALEXANDER C [+5] [-5]
US
SKIADOPOULOS MARIO H
US
COLLINS PETER L
US
MURPHY BRIAN R
US
BAILLY JANE E
CA
DURBIN ANNA P
US
Assignees/Applicants
US HEALTH
US
Priority
US 324284 A  04-Jan-2006 [+11] [-11]
US 78658 A  11-Mar-2005
US 915634 A  10-Aug-2004
US 30544 A  27-Jun-2002
WO 0017066  
US 458813 A  10-Dec-1999
US 83793 A  22-May-1998
US 586479 A  01-Jun-2000
US 459062 A  10-Dec-1999
US 143134 P  09-Jul-1999
US 47575 P  23-May-1997
US 59385 P  19-Sep-1997
Classifications
International (2006.01): A61K 39/12; A61K 39/155
European: A61K 39/155; C12N 7/04
Also Published As
Preview up to the first 8 page images of this publication.
--- Page 1 ---
Page 1
--- Page 2 ---
Page 2
--- Page 3 ---
Page 3
--- Page 4 ---
Page 4
--- Page 5 ---
Page 5
--- Page 6 ---
Page 6
--- Page 7 ---
Page 7
--- Page 8 ---
Page 8
(Source: USPTO)
CROSS-REFERENCES TO RELATED APPLICATIONS
The present application claims priority under 35 USC § 120 as a Continuation Application of U.S. application Ser. No. 11/078,658, filed Mar. 11, 2005, now abandoned, which in turn is a Continuation Application of U.S. application Ser. No. 10/915,634, filed Aug. 10, 2004, now abandoned, which in turn is a Continuation Application of U.S. application Ser. No. 10/030,544, filed Jun. 27, 2002, now abandoned, which in turn is a National Stage Application under 35 USC § 371 of International Application PCT/US00/17066, filed Jun. 15, 2000, which in turn claims priority under 35 USC § 119(e) of U.S. Provisional Application 60/143,134, filed Jul. 9, 1999. The present application also claims priority under 35 USC § 120 as a Continuation-In-Part Application of U.S. application Ser. No. 09/458,813, filed Dec. 10, 1999, issued as U.S. Pat. No. 7,314,631 on Jan. 1, 2008, which in turn is a Continuation-In-Part Application of U.S. application Ser. No. 09/083,793, filed May 22, 1998, issued as U.S. Pat. No. 7,208,161 on Apr. 24, 2007, which in turn claims priority under 35 USC § 119(e) of U.S. Provisional Application 60/059,385, filed Sep. 19, 1997, and U.S. Provisional Application 60/047,575, filed May 23, 1997. The present application also claims priority under 35 USC § 120 as a Continuation-In-Part Application of U.S. application Ser. No. 09/459,062, filed Dec. 10, 1999, issued as U.S. Pat. No. 7,250,171 on Jul. 31, 2007, which in turn is a Continuation-In-Part Application of U.S. application Ser. No. 09/083,793, filed May 22, 1998 and issued as U.S. Pat. No. 7,208,161 on Apr. 24, 2007, which in turn claims priority under 35 USC § 119(e) of U.S. Provisional Application 60/059,385, filed Sep. 19, 1997 and U.S. Provisional Application 60/047,575, filed May 23, 1997. The present application also claims priority under 35 USC § 120 as a Continuation-In-Part Application of U.S. application Ser. No. 09/586,479, filed Jun. 1, 2000, and issued as U.S. Pat. No. 7,201,907 on Apr. 10, 2007, which in turn is a Continuation-In-Part Application of U.S. application Ser No. 09/083,793, filed May 22, 1998 and issued as U.S. Pat. No. 7,208,161 on Apr. 24, 2007, which in turn claims priority under 35 USC § 119(e) of U.S. Provisional Application 60/059,385, filed Sep. 19, 1997and U.S. Provisional Application 60/047,575, filed May 23, 1997.
BACKGROUND OF THE INVENTION
Human parainfluenza virus type 3 (HPIV3) is a common cause of serious lower respiratory tract infection in infants and children less than one year of age. It Is second only to respiratory syncytial virus (RSV) as a leading cause of hospitalization for viral lower respiratory tract disease in this age group (Collins et al., in B. N. Fields Virology, p. 1205-1243, 3rd ed., vol. 1., Knipe et al., eds., Lippincott-Raven Publishers, Philadelphia, 1996; Crowe et al., Vaccine 13:415-421, 1995; Marx et al., J. Infect. Dis. 176:1423-1427, 1997, all incorporated herein by reference). Infections by this virus result in substantial morbidity in children less than 3 years of age. HPIV1 and HPIV2 are the principal etiologic agents of laryngotracheobronchitis (croup) and also can cause severe pneumonia and bronchiolitis (Collins et al., 1996, supra). In a long term study over a 20-year period, HPIV1, HPIV2, and HPIV3 were identified as etiologic agents for 6.0, 3.2, and 11.5%, respectively, of hospitalizations for respiratory tract disease accounting in total for 18% of the hospitalizations, and, for this reason, there is a need for an effective vaccine (Murphy et al., Virus Res. 11:1-15, 1988). The parainfluenza viruses have also been identified in a significant proportion of cases of virally-induced middle ear effusions in children with otitis media (Heikkinen et al., N. Engl. J. Med. 340:260-264, 1999, incorporated herein by reference). Thus, there is a need to produce a vaccine against these viruses that can prevent the serious lower respiratory tract disease and the otitis media that accompanies these HPIV infections. HPIV1, HPIV2, and HPIV3 are distinct serotypes that do not elicit significant cross-protective immunity. The major protective antigens of PIVs are the hemeagglutinin (HN) and fusion (F) glycoproteins, which mediate viral attachment, penetration and release. Protection against reinfection is mediated primarily by virus-neutralizing antibodies.
Despite considerable efforts to develop effective vaccine therapies against HPIV, approved vaccine agents that prevent HPIV related illness have not yet been achieved. The most promising prospects to date are live attenuated vaccine viruses since these have been shown to be efficacious in non-human primates even in the presence of passively transferred antibodies, an experimental situation that simulates that present in the very young infant who possesses maternally acquired antibodies (Crowe et al., 1995, supra; and Durbin et al., J. Infect. Dis. 179:1345-1351, 1999a; each incorporated herein by reference). Two live attenuated PIV3 vaccine candidates, a temperature-sensitive (ts) derivative of the wild type PIV3 JS strain (designated PIV3cp45) and a bovine PIV3 (BPIV3) strain, are undergoing clinical evaluation (Karron et al., Pediatr. Infect. Dis. J. 15:650-654, 1996; Karron et al., 1995a, supra; Karron et al., 1995b, supra; each incorporated herein by reference). The BPIV3 vaccine candidate is attenuated, genetically stable and immunogenic in human infants and children. A second PIV3 vaccine candidate, JS cp45, is a cold-adapted mutant of the JS wildtype (wt) strain of HPIV3 (Karron et al., 1995b, supra; and Belshe et al., J. Med. Virol. 10:235-242, 1982a; each incorporated herein by reference). This live, attenuated, cold-passaged (cp) PIV3 vaccine candidate exhibits temperature-sensitive (ts), cold-adaptation (ca), and attenuation (att) phenotypes, which are stable after viral replication in vivo. The cp45 virus is protective against human PIV3 challenge in experimental animals and is attenuated, genetically stable, and immunogenic in seronegative human infants and children (Belshe et al., 1982a, supra; Belshe et al., Infect. Immun. 37:160-165, 1982b; Clements et al., J. Clin. Microbiol. 29:1175-1182, 1991; Crookshanks et al., J. Med. Virol. 13:243-249, 1984; Hall et al., Virus Res. 22:173-184, 1992; Karron et al., 1995b, supra; each incorporated herein by reference). Because these PIV3 candidate vaccine viruses are biologically derived there is no proven method for adjusting their level of attenuation as will likely be necessary for broad clinical application.
To facilitate development of PIV vaccine candidates, recombinant DNA technology has recently made it possible to recover infectious negative-strand RNA viruses from cDNA (for reviews, see Conzelmann, J. Gen. Virol. 77:381-389, 1996; Palese et al., Proc. Natl. Acad. Sci. U.S.A. 93:11354-11358, 1996; each incorporated herein by reference). In this context, rescue of recombinant viruses has been reported for infectious respiratory syncytial virus (RSV), rabies virus (RaV), simian virus 5 (SV5), rinderpest virus, Newcastle disease virus (NDV), vesicular stomatitis virus (VSV), measles virus (MeV), mumps virus (MuV) and Sendai virus (SeV) from cDNA-encoded antigenomic RNA in the presence of essential viral proteins (see, e.g., Garcin et al., EMBO J. 14:6087-6094, 1995; Lawson et al., Proc. Natl. Acad. Sci. U.S.A. 92:4477-4481, 1995; Radecke et al., EMBO J. 14:5773-5784, 1995; Schnell et al., EMBO J. 13:4195-4203, 1994; Whelan et al., Proc. Natl. Acad. Sci. U.S.A. 92:8388-8392, 1995; Hoffman et al., J. Virol. 71:4272-4277, 1997; Kato et al., Genes to Cells 1:569-579, 1996, Roberts et al., Virology 247:1-6, 1998; Baron et al., J. Virol. 71:1265-1271, 1997; International Publication No. WO 97/06270; Collins et al., Proc. Natl. Acad. Sci. USA 92:11563-11567, 1995; U.S. patent application Ser. No. 08/892,403, filed Jul. 15, 1997 (corresponding to published International Application No. WO 98/02530 and priority U.S. Provisional Application Nos. 60/047,634, filed May 23, 1997, 60/046,141, filed May 9, 1997, and 60/021,773, filed July 15, 1996); U.S. patent application Ser. No. 09/291,894, filed on Apr. 13, 1999; U.S. Provisional Patent Application Ser. No. 60/129,006, filed Apr. 13, 1999; U.S. Provisional Patent Application Ser. No. 60/143,097, filed by Bucholz et al. on Jul. 9, 1999; Juhasz et al., J. Virol. 71:5814-5819, 1997; He et al. Virology 237:249-260, 1997; Peters et al. J. Virol. 73:5001-5009, 1999; Whitehead et al., Virology 247:232-239, 1998a; Whitehead et al., J. Virol. 72:4467-4471, 1998b; Jin et al. Virology 251.:206-214, 1998; Bucholz et al. J. Virol. 73:251-259, 1999; Whitehead et al., J. Virol. 73:3438-3442, 1999, and Clarke et al., J. Virol. 74:4831-4838, 2000; each incorporated herein by reference in its entirety for all purposes).
In more specific regard to the instant invention, a method for producing HPIV with a wt phenotype from cDNA was recently developed for recovery of infectious, recombinant HPIV3 JS strain (see, e.g., Durbin et al., Virology 235:323-332, 1997a; U.S. patent application Ser. No. 09/083,793, filed May 22, 1998; U.S. Provisional Application Ser. No. 60/047,575, filed May 23, 1997 (corresponding to International Publication No. WO 98/53078), and U.S. Provisional Application Ser. No. 60/059,385, filed Sep. 19, 1997, each incorporated herein by reference). In addition, these disclosures allow for genetic manipulation of viral cDNA clones to determine the genetic basis of phenotypic changes in biological mutants, e.g., which mutations in the HPIV3 cp45 virus specify its ts, ca and att phenotypes, and which gene(s) or genome segment(s) of BPIV3 specify its attenuation phenotype. Additionally, these and related disclosures render it feasible to construct novel PIV vaccine candidates having a wide range of different mutations and to evaluate their level of attenuation, immunogenicity and phenotypic stability (see also, U.S. Provisional Patent Application Ser. No. 60/143,134, filed by Bailly et al. on Jul. 9, 1999; and U.S. patent application Ser. No. 09/350,821, filed by Durbin et al. on Jul. 9, 1999; each incorporated herein by reference).
Thus, infectious wild type recombinant PIV3 (r)PIV3, as well as a number of ts derivatives, have now been recovered from cDNA, and reverse genetics systems have been used to generate infectious virus bearing defined attenuating mutations and to study the genetic basis of attenuation of existing vaccine viruses. For example, the three amino acid substitutions found in the L gene of cp45, singularly or in combination, have been found to specify the ts and attenuation phenotypes. Additional is and attenuating mutations are present in other regions of the PIV3 cp45. In addition a chimeric PIV1 vaccine candidate has been generated using the PIV3 cDNA rescue system by replacing the PIV3 HN and F open reading frames (ORFs) with those of PIV1 in a PIV3 full-length cDNA that contains the three attenuating mutations in L. The recombinant chimeric virus derived from this cDNA is designated rPIV3-1.cp45L (Skiadopoulos et al., J. Virol. 72:1762-1768, 1998; Tao et al., J. Virol. 72:2955-2961, 1998; Tao et al., Vaccine 17:1100-1108, 1999, incorporated herein by reference). rPIV3-1.cp45L was attenuated in hamsters and induced a high level of resistance to challenge with PIV1. A recombinant chimeric virus, designated rPIV3-1.cp45, has been produced that contains 12 of the 15 cp45 mutations, i.e., excluding the mutations that occur in HN and F, and is highly attenuated in the upper and lower respiratory tract of hamsters (Skiadopoulos et al., Vaccine 18:503-510, 1999a).
BPIV3, which is antigenically-related to HPIV3, offers an alternative approach to the development of a live attenuated virus vaccine for HPIV1, HPIV2, and HPIV3. The first vaccine used in humans, live vaccinia virus believed to be of bovine origin, was developed by Jenner almost 200 years ago for the control of smallpox. During the ensuing two centuries, vaccinia virus was successful in controlling this disease and played an essential role in the final eradication of smallpox. In this “Jennerian” approach to vaccine development, an antigenically-related animal virus is used as a vaccine for humans. Animal viruses that are well adapted to their natural host often do not replicate efficiently in humans and hence are attenuated. At present, there is a lack of a thorough understanding regarding the genetic basis for this form of host range restriction. Evolution of a virus in its mammalian or avian host results in significant divergence of nucleotide (nt) and amino acid sequences from that of the corresponding sequences in the related human virus. This divergent sequence, consisting of a large number of sequence differences, specifies the host range attenuation phenotype. Having an attenuation phenotype which is based on numerous sequence differences is a desirable property in a vaccine virus since it should contribute to the stability of the attenuation phenotype of the animal virus following its replication in humans.
The recently licensed quadrivalent rotavirus is an example of the Jennerian approach to vaccine development in which a nonhuman rotavirus strain, the rhesus rotavirus (RRV), was found to be attenuated in humans and protective against human serotype 3 to which it is antigenically highly related (Kapikian et al., Adv. Exp. Med. Biol. 327:59-69, 1992). Since there was a need for a multivalent vaccine that would induce resistance to each of the four major human rotavirus serotypes, the Jennerian approach was modified by constructing three reassortant viruses using conventional genetic techniques of gene reassortment in tissue culture. Each single gene reassortant virus contained 10 RRV genes plus a single human rotavirus gene that coded for the major neutralization antigen (VP7) of serotype 1, 2, or 4. The intent was to prepare single gene substitution RRV reassortants with the attenuation characteristics of this simian virus and the neutralization specificity of human rotavirus serotype 1, 2, or 4. The quadrivalent vaccine based on the host range restriction of the simian RRV in humans provided a high level of efficacy against human rotavirus infection in infants and young children (Perez-Schael et al., N. Engl. J. Med. 337:1181-1187, 1997). However, the vaccine virus retains mild reactogenicity in older seronegative infants lacking maternal antibody, therefore a second generation Jennerian vaccine, based on the UK strain of bovine rotavirus, is being developed to replace the RRV vaccine (Clements-Mann et al., Vaccine 17:2715-2725, 1999).
The Jennerian approach also is being explored to develop vaccines for parainfluenza type 1 virus and for hepatitis A virus which are attenuated and immunogenic in non-human primates (Emerson et al., J. Infect. Dis. 173:592-597, 1996; Hurwitz et al., Vaccine 15:533-540, 1997). The Jennerian approach was used for the development of a live attenuated vaccine for influenza A virus but it failed to produce a consistently attenuated vaccine for use in humans (Steinhoff et al., J. Infect. Dis. 163:1023-1028, 1991). As another example, reassortant viruses that contain two gene segments encoding the hemagglutinin and neuraminidase surface glycoproteins from a human influenza A virus and the six remaining gene segments from an avian influenza A virus were attenuated in humans (Clements et al., J. Clin. Microbiol. 27:219-222, 1989; Murphy et al., J. Infect. Dis. 152:225-229, 1985; and Snyder et al., J. Clin. Microbiol. 23:852-857, 1986). This indicated that one or more of the six gene segments of the avian virus attenuated the avian-human influenza A viruses for humans. The genetic determinants of this attenuation were mapped using reassortant viruses possessing a single gene segment from an attenuating avian influenza A virus and the remaining genes from a human strain. It was shown that the nonstructural (NS), polymerase (PB1, PB2) and M genes contributed to the attenuation phenotype of avian influenza A viruses in humans (Clements et al., J. Clin. Microbiol. 30:655-662, 1992).
In another study, the severe host range restriction of bovine respiratory syncytial virus (BRSV) for replication in chimpanzees was only slightly alleviated by replacement of the BRSV F and G glycoproteins with their HRSV counterparts. This indicated that F and G are involved in this host range restriction, but that one or more additional bovine RSV genes are also involved (Buchholz et al., J. Virol. 74:1187-1199, 2000). This illustrates that more than one gene can contribute in unpredictable ways to the host range restriction phenotype of a mammalian or avian virus in primates.
The instant invention provides a new basis for attenuating a wild type or mutant parental virus for use as a vaccine against HPIV, in which attenuation is based completely or in part on host range effects, while at least one or more of the major neutralization and protective antigenic determinant(s) of the chimeric virus is homologous to the virus against which the vaccine is directed. The HN and F proteins of BPIV3 are each approximately 80% related by amino acid sequence to their corresponding HPIV3 proteins (Suzu et al., Nucleic Acids Res. 15:2945-2958, 1987, incorporated herein by reference) and 25% related by antigenic analysis (Coelingh et al., J. Virol. 64:3833-3843, 1990; Coelingh et al., J. Virol. 60:90-96, 1986; van Wyke Coelingh et al., J. Infect. Dis. 157:655-662, 1988, each incorporated herein by reference). Previous studies indicated that two strains of BPIV3, the Kansas (Ka) strain and the Shipping Fever (SF) prototype strain, were attenuated for the upper and lower respiratory tract of rhesus monkeys, and one of these, the Ka strain, was attenuated in chimpanzees (van Wyke Coelingh et al., 1988, supra, incorporated herein by reference). Immunization of nonhuman primates with the Ka virus induced antibodies reactive with HPIV3 and induced resistance to the replication of the human virus in the upper and the lower respiratory tract of monkeys (id.) Subsequent evaluation of the Ka strain in humans indicated that the virus was satisfactorily attenuated for seronegative infants, and it retained the attenuation phenotype following replication in filly susceptible infants and children (Karron et al., 1996, supra; and Karron et al., 1995a, supra; each incorporated herein by reference). Its major advantages therefore were that it was satisfactorily attenuated for fully susceptible seronegative infants and children, and its attenuation phenotype was stable following replication in humans.
However, the level of serum hemagglutination-inhibiting antibodies reactive with HPIV3 induced in seronegative vaccinees who received 105.0 tissue culture infectious dose50(TCID)50 of the Ka strain of BPIV3 was 1:1 0.5, which was three-fold lower than similar vaccinees who received a live attenuated HPIV3 vaccine (Karron et al., 1995a, supra; and Karron et al., 1995b, supra; each incorporated herein by reference). This lower level of antibodies to the human virus induced by BPIV3 reflected in large part the antigenic divergence between HPIV3 and BPIV3 (Karron et al., 1996, supra; and Karron et al., 1995a, supra; each incorporated herein by reference). Studies to determine the efficacy of the Ka vaccine candidate against HPIV3 in humans have not been performed, but it is likely that this reduced level of antibodies reactive with BPIV3 will be reflected in a reduced level of protective efficacy.
Although it is clear that BPIV3 has host range genes that restrict replication in the respiratory tract of rhesus monkeys, chimpanzees and humans, it remains unknown which of the bovine proteins or noncoding sequences contribute to this host range restriction of replication. It is possible that any of the BPIV3 proteins or noncoding sequences may confer a host range phenotype. It is not possible to determine in advance which genes or genome segments will confer an attenuation phenotype. This can only be accomplished by systematic substitution of BPIV3 coding and non-coding sequences for their HPIV3 counterparts and by evaluation-of the recovered HPIV3/BPIV3 chimeric viruses in seronegative rhesus monkeys or humans.
Despite the numerous advances toward development of effective vaccine agents against PIV serotypes 1, 2, and 3, there remains a clear need in the art for additional tools and methods to engineer safe and effective vaccines to alleviate the serious health problems attributable to PIV, particularly illnesses among infants and children due to infection by HPIV. Among the remaining challenges in this context is the need for additional tools to generate suitably attenuated, immunogenic and genetically stable vaccine candidates for use in diverse clinical settings. To facilitate these goals, existing methods for identifying and incorporating attenuating mutations into recombinant vaccine strains must be expanded. Furthermore, it is recognized that methods and compositions for designing vaccines against human PIV can be implemented as well to design novel vaccine candidates for veterinary use. Surprisingly, the present invention fulfills these needs and provides additional advantages as described hereinbelow.
SUMMARY OF THE INVENTION
The present invention provides human-bovine chimeric parainfluenza viruses (PIVs) that are infectious and attenuated in humans and other mammals. In related aspects, the invention provides novel methods for designing and producing attenuated, human-bovine chimeric PIVs that are useful in various compositions to generate a desired immune response against PIV in a host susceptible to PIV infection. Included within these aspects of the invention are novel, isolated polynucleotide molecules and vectors incorporating such molecules that comprise a chimeric PIV genome or antigenome including a partial or complete human or bovine PIV “background” genome or antigenome combined or integrated with one or more heterologous gene(s) or genome segment(s) of a different PIV virus. Also provided within the invention are methods and compositions incorporating human-bovine chimeric PIV for prophylaxis and treatment of PIV infection.
The invention thus involves a method for developing live attenuated PIV vaccine candidates based on chimeras between HPIVs and BPIV3. Chimeras are generated using a cDNA-based virus recovery system. Recombinant viruses made from cDNA replicate independently and are propagated in the same manner as if they were biologically-derived viruses. Chimeric human-bovine PIV of the invention are recombinantly engineered to incorporate nucleotide sequences from both human and bovine PIV strains to produce an infectious, chimeric virus or subviral particle. In this manner, candidate vaccine viruses are recombinantly engineered to elicit an immune response against PIV in a mammalian host susceptible to PIV infection, including humans and non-human primates. Human-bovine chimeric PIV according to the invention may be engeneered to elicit an immune response to a specific PIV, e.g., HPIV3, or a polyspecific response against multiple PIVs, e.g., HPIV1 and HPIV3. Additional chimeric viruses can be designed in accordance with the teachings herein which serve as vectors for antigens of non-PIV pathogens, for example respiratory syncytial virus (RSV) or measles virus.
Exemplary human-bovine chimeric PIV of the invention incorporate a chimeric PIV genome or antigenome comprising both human and bovine polynucleotide sequences, as well as a major nucleocapsid (N) protein, a nucleocapsid phosphoprotein (P), and a large polymerase protein (L). Additional PIV proteins may be included in various combinations to provide a range of infectious subviral particles, up to a complete viral particle or a viral particle containing supernumerary proteins, antigenic determinants or other additional components.
Chimeric human-bovine PIV of the invention include a partial or complete “background” PIV genome or antigenome derived from or patterned after a human or bovine PIV strain or subgroup virus combined with one or more heterologous gene(s) or genome segment(s) of a different PIV strain or subgroup virus to form the human-bovine chimeric PIV genome or antigenome. In preferred aspects of the invention, chimeric PIV incorporate a partial or complete human PIV background genome or antigenome combined with one or more heterologous gene(s) or genome segment(s) from a bovine PIV.
The partial or complete background genome or antigenome typically acts as a recipient backbone or vector into which are imported heterologous genes or genome segments of the counterpart, human or bovine PIV. Heterologous genes or genome segments from the counterpart, human or bovine PIV represent “donor” genes or polynucleotides that are combined with, or substituted within, the background genome or antigenome to yield a human-bovine chimeric PIV that exhibits novel phenotypic characteristics compared to one or both of the contributing PIVs. For example, addition or substitution of heterologous genes or genome segments within a selected recipient PIV strain may result in an increase or decrease in attenuation, growth changes, altered immunogenicity, or other desired phenotypic changes as compared with a corresponding phenotype(s) of the unmodified recipient and/or donor.
Genes and genome segments that may be selected for use as heterologous substitutions or additions within human-bovine chimeric PIV of the invention include genes or genome segments encoding a PIV N, P, C, D, V, M, F, SH (where appropriate), HN and/or L protein(s) or portion(s) thereof. In addition, genes and genome segments encoding non-PIV proteins, for example, an SH protein as found in mumps and SV5 viruses, may be incorporated within human-bovine PIV of the invention. Regulatory regions, such as the extragenic 3′ leader or 5′ trailer regions, and gene-start, gene-end, intergenic regions, or 3′ or 5′ non-coding regions, are also useful as heterologous substitutions or additions.
Preferred human-bovine chimeric PIV vaccine candidates of the invention bear one or more of the major antigenic determinants of HPIV3 in a background which is attenuated by the substitution or addition of one or more BPIV3 genes or genome segments. The major protective antigens of PIVs are their HN and F glycoproteins, although other proteins can also contribute to a protective immune response. In certain embodiments, the background genome or antigenome is an HPIV genome or antigenome, e.g., an HPIV3, HPIV2, or HPIV1 background genome or antigenome, to which is added or into which is substituted one or more BPIV gene(s) or genome segment(s), preferably from BPIV3. In one exemplary embodiment described below, an ORF of the N gene of a BPIV3 is substituted for that of an HPIV. Alternatively, the background genome or antigenome may be a BPIV genome or antigenome which is combined with one or more genes or genome segments encoding a HPIV3, HPIV2, or HPIV1 glycoprotein, glycoprotein domain or other antigenic determinant.
In accordance with the methods of the invention, any BPIV gene or genome segment, singly or in combination with one or more other BPIV genes, can be combined with HPIV sequences to give rise to a human-bovine chimeric PIV vaccine candidate. Any HPIV, including different strains of a particular HPIV serotype, e.g., HPIV3 will be a reasonable acceptor for attenuating BPIV gene(s). In general, the HPIV3 gene(s) or genome segment(s) selected for inclusion in a human-bovine chimeric PIV for use as a vaccine against human PIV will include one or more of the HPIV protective antigens such as the HN or F glycoproteins.
In exemplary aspects of the invention, human-bovine chimeric PIV bearing one or more bovine gene(s) or genome segment(s) exhibits a high degree of host range restriction, e.g., in the respiratory tract of mammalian models of human PIV infection such as non-human primates. In exemplary embodiments a human PIV is attenuated by the addition or substitution of one or more bovine gene(s) or genome segment(s) to a partial or complete human, e.g., HPIV3, PIV background genome or antigenome. In one example, the HPIV3 N gene is substituted by the BPIV3 N gene to yield a novel human-bovine chimeric PIV vaccine candidate.
Preferably, the degree of host range restriction exhibited by human-bovine chimeric PIV vaccine candidates of the invention is comparable to the degree of host range restriction exhibited by the respective BPIV parent or “donor” strain. Preferably, the restriction should have a true host range phenotype, i.e., it should be specific to the host in question and should not restrict replication and vaccine preparation in vitro in a suitable cell line. In addition, human-bovine chimeric PIV bearing one or more bovine gene(s) or genome segment(s) elicit a high level of resistance in hosts susceptible to PIV infection. Thus, the invention provides a new basis for attenuating a live virus vaccine against PIV, one which is based on host range effects due to the introduction of one or more gene(s) or genome segment(s) from a heterologous PIV, e.g., between HPIV3 and BPIV3.
In related aspects of the invention, human-bovine chimeric PIV incorporates one or more heterologous gene(s) that encode an HPIV HN and/or F glycoprotein(s). Alternatively, the chimeric PIV may incorporate one or more genome segment(s) encoding an ectodomain (and alternatively a cytoplasmic domain and/or transmembrane domain), or immunogenic epitope of an HPIV HN and/or F glycoprotein(s). These immunogenic proteins, domains and epitopes are particularly useful within human-bovine chimeric PIV because they generate novel immune responses in an immunized host. In particular, the HN and F proteins, and immunogenic domains and epitopes therein, provide major protective antigens.
In certain embodiments of the invention, addition or substitution of one or more immunogenic gene(s) or genome segment(s) from a human PIV subgroup or strain to or within a bovine background, or recipient, genome or antigenome yields a recombinant, chimeric virus or subviral particle capable of generating an immune response directed against the human donor virus, including one or more specific human PIV subgroups or strains, while the bovine backbone confers an attenuated phenotype making the chimera a useful candidate for vaccine development. In one exemplary embodiment, one or more human PIV glycoprotein genes, e.g., HN and/or F, are added to or substituted within a partial or complete bovine genome or antigenome to yield an attenuated, infectious human-bovine chimera that elicits an anti-human PIV immune response in a susceptible host.
In alternate embodiments, human-bovine chimeric PIV additionally incorporate a gene or genome segment encoding an immunogenic protein, protein domain or epitope from multiple human PIV strains, for example two HN or F proteins or immunogenic portions thereof each from a different HPIV, e.g., HPIV1 or HPIV2. Alternatively, one glycoprotein or immunogenic determinant may be provided from a first HPIV, and a second glycoprotein or immunogenic determinant may be provided from a second HPIV by substitution without the addition of an extra glycoprotein- or determinant-encoding polynucleotide to the genome or antigenome. Substitution or addition of BPIV glycoproteins and antigenic determinants may also be achieved by construction of a genome or antigenome that encodes a chimeric glycoprotein in the recombinant virus or subviral particle, for example having an immunogenic epitope, antigenic region or complete ectodomain of a first HPIV fused to a cytoplasmic domain of a heterologous HPIV. For example, a heterologous genome segment encoding a glycoprotein ectodomain from a HPIV1 or BPIV2 HN or F glycoprotein may be joined with a genome segment encoding a corresponding HPIV3 HN or F glycoprotein cytoplasmic/endodomain in the background genome or antigenome.
In alternate embodiments a human-bovine chimeric PIV genome or antigenome may encode a substitute, extra, or chimeric glycoprotein or antigenic determinant thereof in the recombinant virus or subviral particle, to yield a viral recombinant having both human and bovine glycoproteins, glycoprotein domains, or immunogenic epitopes. For example, a heterologous genome segment encoding a glycoprotein ectodomain from a human PIV HN or F glycoprotein may be joined with a genome segment encoding a corresponding bovine HN or F glycoprotein cytoplasmic/endodomain in the background genome or antigenome. Alternatively, the human PIV HN or F glycoprotein or parts thereof may be joined with a genome segment encoding an HN or F glycoprotein or parts thereof from another PIV strain or serotype.
Thus, according to the methods of the invention, human-bovine chimeric PIV may be constructed by substituting the heterologous gene or genome segment for a counterpart gene or genome segment in a partial PIV background genome or antigenome. Alternatively, the heterologous gene or genome segment may be added as a supernumerary gene or genome segment in combination with a complete (or partial if another gene or genome segment is deleted) PIV background genome or antigenome. For example, two human PIV HN or F genes or genome segments can be included, one each from HPIV2 and HPIV3.
Often, a heterologous gene or genome segment is added near an intergenic position within a partial or complete PIV background genome or antigenome. Alternatively, the gene or genome segment can be placed in other noncoding regions of the genome, for example, within the 5′ or 3′ noncoding regions or in other positions where noncoding nucleotides occur within the partial or complete genome or antigenome. In one aspect, noncoding regulatory regions contain cis-acting signals required for efficient replication, transcription, and translation, and therefore represent target sites for modification of these functions by introducing a heterologous gene or genome segment or other mutation as disclosed herein.
In more detailed aspects of the invention, attenuating mutations are introduced into cis-acting regulatory regions to yield, e.g., (1) a tissue specific attenuation (Gromeier et al., J. Virol. 73:958-964, 1999; Zimmermann et al., J. Virol. 71:4145-4149, 1997), (2) increased sensitivity to interferon (Zimmermann et al., 1997, supra), (3) temperature sensitivity (Whitehead et al., 1998a, supra), (4) a general restriction in level of replication (Men et al., J. Virol. 70:3930-3937, 1996; Muster et al., Proc. Natl. Acad. Sci. USA 88:5177-5181, 1991), and/or (5) host specific restriction of replication (Cahour et al., Virology 207:68-76, 1995). These attenuating mutations can be achieved in various ways to produce an attenuated human-bovine chimeric PIV of the invention, for example by point mutations, swaps of sequences between related viruses, or nucleotide deletions.
In yet additional alternative methods provided herein, a heterologous gene or genome segment may be added or substituted at a position corresponding to a wild-type gene order position of a counterpart gene or genome segment within the partial or complete PIV background genome or antigenome. In other embodiments, the heterologous gene or genome segment is added or substituted at a position that is more promoter-proximal or promotor-distal compared to a wild-type gene order position of a counterpart gene or genome segment within the background genome or antigenome, to enhance or reduce expression, respectively, of the heterologous gene or genome segment.
In general aspects of the invention, bovine genes or genome segments may be added to or substituted within a human PIV background to form an attenuated, human-bovine chimeric PIV. Alternatively, the chimera may be comprised of one or more human gene(s) or genome segment(s) added to or substituted within a bovine PIV background to form an attenuated PIV vaccine candidate. In this context, a chimeric PIV genome or antigenome is formed of a partial or complete bovine PIV background genome or antigenome combined with a heterologous gene or genome segment from a human PIV. In preferred aspects, one or more bovine PIV gene(s) or genome segment(s) is substituted for a counterpart gene(s) or genome segment(s) within a human PIV background genome or antigenome. In alternate embodiments, one or more human PIV glycoprotein genes, e.g., HN and/or F or a genome segment encoding a cytoplasmic domain, transmembrane domain, ectodomain or immunogenic epitope of a human PIV glycoprotein gene is substituted for a counterpart gene or genome segment within the bovine PIV background genome or antigenome. For example, both human PIV glycoprotein genes HN and F may be substituted to replace counterpart HN and F glycoprotein genes in a bovine PIV background genome or antigenome.
In a parallel fashion, the chimeric human-bovine PIV of the invention can be readily designed as “vectors” to incorporate antigenic determinants from different pathogens, including more than one PIV strain or group (e.g., both human PIV3 and human PIV1), respiratory syncytial virus (RSV), measles and other pathogens (see, e.g., U.S. Provisional Patent Application Ser. No. 60/170,195, filed Dec. 10, 1999 by Murphy et al., incorporated herein by reference).
In more detailed aspects of the invention, human-bovine chimeric PIV are comprised of a partial or complete BPIV background genome or antigenome combined with one or more heterologous gene(s) or genome segment(s) from a human PIV. Within these aspects, one or more of the HPIV glycoprotein genes HN and F, or one or more genome segments encoding a cytoplasmic domain, transmembrane domain, ectodomain or immunogenic epitope of the HN and/or F genes, may be added to a BPIV background genome or antigenome or substituted for one or more counterpart genes or genome segments within the BPIV background genome or antigenome to yield the chimeric construct. Often, both HPIV glycoprotein genes HN and F will be substituted to replace counterpart HN and F glycoprotein genes in the BPIV background genome or antigenome, as exemplified by the recombinant chimeric virus rBPIV3-FHHNH described below. This is a desirable construct because it combines the antigenic determinants of the human PIV with the host range restricting elements of the bovine PIV.
In combination with the host range phenotypic effects provided in the human-bovine chimeric PIV of the invention, it is often desirable to adjust the attenuation phenotype by introducing additional mutations that increase or decrease attenuation of the chimeric virus. Thus, in additional aspects of the invention, attenuated, human-bovine chimeric PIV are produced in which the chimeric genome or antigenome is further modified by introducing one or more attenuating mutations specifying an attenuating phenotype in the resultant virus or subviral particle. These can include mutations in RNA regulatory sequences or in encoded proteins. These attenuating mutations may be generated de novo and tested for attenuating effects according to a rational design mutagenesis strategy. Alternatively, the attenuating mutations may be identified in existing biologically derived mutant PIV and thereafter incorporated into a human-bovine chimeric PIV of the invention.
Introduction of attenuating and other desired phenotype-specifying mutations into chimeric bovine-human PIV of the invention may be achieved by transferring a heterologous gene or genome segment, e.g., a gene encoding an L protein or portion thereof, into a bovine or human PIV background genome or antigenome. Alternatively, the mutation may be present in the selected background genome or antigenome, and the introduced heterologous gene or genome segment may bear no mutations or may bear one or more different mutations. Typically, the human or bovine background or “recipient” genome or antigenome is modified at one or more sites corresponding to a site of mutation in a heterologous virus (e.g., a heterologous bovine or human PIV or a non-PIV negative stranded RNA virus) to contain or encode the same or a conservatively related mutation (e.g., a conservative amino acid substitution) as that identified in the donor virus (see, PCT/US00/09695 filed Apr. 12, 2000 and its priority U.S. Provisional Patent Application Ser. No. 60/129,006, filed Apr. 13, 1999, incorporated herein by reference). In one exemplary embodiment, a bovine background or “recipient” genome or antigenome is modified at one or more sites corresponding to a site of mutation in HPIV3 JS cp45, as enumerated below, to contain or encode the same or a conservatively related mutation as that identified in the cp45 “donor.”
Preferred mutant PIV strains for identifying and incorporating attenuating mutations into bovine-human chimeric PIV of the invention include cold passaged (cp), cold adapted (ca), host range restricted (hr), small plaque (sp), and/or temperature sensitive (ts) mutants, for example the JS HPIV3 cp 45 mutant strain. In exemplary embodiments, one or more attenuating mutations occur in the polymerase L protein, e.g., at a position corresponding to Tyr942, Leu992, or Thr1558 of JS wild type HPIV3. Alternatively, attenuating mutations in the N protein may be selected and incorporated in a human-bovine chimeric PIV, for example which encode amino acid substitution(s) at a position corresponding to residues Val96 or Ser389 of JS. Alternative or additional mutations may encode amino acid substitution(s) in the C protein, e.g., at a position corresponding to Ile96 of JS and in the M protein, e.g., at a position corresponding to Pro199 (for example a Pro199 to Thr mutation). Yet additional mutations for adjusting attenuation of a human-bovine chimeric PIV of the invention are found in the F protein, e.g., at a position corresponding to Ile420 or Ala450 of JS, and in the HN protein, e.g., at a position corresponding to residue Val384 of JS.
Attenuating mutations from biologically derived PIV mutants for incorporation into human-bovine chimeric PIV of the invention also include mutations in noncoding portions of the PIV genome or antigenome, for example in a 3′ leader sequence. Exemplary mutations in this context may be engineered at a position in the 3′ leader of a recombinant virus at a position corresponding to nucleotide 23, 24, 28, or 45 of JS cp45. Yet additional exemplary mutations may be engineered in the N gene start sequence, for example by changing one or more nucleotides in the N gene start sequence, e.g., at a position corresponding to nucleotide 62 of JS cp45.
From JS cp45 and other biologically derived PIV and non-PIV mutants, a large “menu” of attenuating mutations is provided, each of which mutations can be combined with any other mutation(s) for adjusting the level of attenuation in a recombinant PIV bearing a genome or antigenome that is a chimera of human and bovine gene(s) or genome segment(s). For example, mutations within recombinant PIV of the invention include one or more, and preferably two or more, mutations of JS cp45. Desired human-bovine chimeric PIV of the invention selected for vaccine use often have at least two and sometimes three or more attenuating mutations to achieve a satisfactory level of attenuation for broad clinical use. Preferably, recombinant human-bovine chimeric PIV incorporate one or more attenuating mutation(s) stabilized by multiple nucleotide substitutions in a codon specifying the mutation.
Additional mutations which can be adopted or transferred to human-bovine chimeric PIV of the invention may be identified in non-PIV nonsegmented negative standed RNA viruses and incorporated in PIV mutants of the invention. This is readily accomplished by mapping the mutation identified in a heterologous negative stranded RNA virus to a corresponding, homologous site in a recipient PIV genome or antigenome and mutating the existing sequence in the recipient to the mutant genotype (either by an identical or conservative mutation), as described in PCT/US00/09695 filed Apr. 12, 2000 and its priority U.S. Provisional Patent Application Ser. No. 60/129,006, filed Apr. 13, 1999, incorporated herein by reference.
In addition to recombinant human-bovine chimeric PIV, the invention provides related cDNA clones, vectors and particles, each of which incorporate HPIV and BPIV sequences and, optionally, one or more of the additional, phenotype-specific mutations set forth herein. These are introduced in selected combinations, e.g., into an isolated polynucleotide which is a recombinant cDNA genome or antigenome, to produce a suitably attenuated, infectious virus or subviral particle upon expression, according to the methods described herein. This process, coupled with routine phenotypic evaluation, provides human-bovine chimeric PIV having such desired characteristics as attenuation, temperature sensitivity, altered immunogenicity, cold-adaptation, small plaque size, host range restriction, genetic stability, etc. In particular, vaccine candidates are selected which are attenuated and yet are sufficiently immunogenic to elicit a protective immune response in the vaccinated mammalian host.
In yet additional aspects of the invention, human-bovine chimeric PIV, with or without additional mutations adopted, e.g., from a biologically derived attenuated mutant virus, are constructed to have additional nucleotide modification(s) to yield a desired phenotypic, structural, or functional change. Typically, the selected nucleotide modification will specify a phenotypic change, for example a change in growth characteristics, attenuation, temperature-sensitivity, cold-adaptation, plaque size, host range restriction, or immunogenicity. Structural changes in this context include introduction or ablation of restriction sites into PIV encoding cDNAs for ease of manipulation and identification.
In preferred embodiments, nucleotide changes within the genome or antigenome of a human-bovine chimeric PIV include modification of a viral gene by partial or complete deletion of the gene or reduction or ablation (knock-out) of its expression. These modifications can be introduced within the human or bovine background genome or antigenome, or may be introduced into the chimeric genome or antigenome by incorporation within the heterologous gene(s) or genome segment(s) added or substituted therein. Target genes for mutation in this context include any of the PIV genes, including the nucleocapsid protein N, phosphoprotein P, large polymerase subunit L, matrix protein M, hemagglutinin-neuraminidase protein HN, small hydrophobic SH protein, where applicable, fusion protein F, and the products of the C, D and V open reading frames (ORFs). To the extent that the recombinant virus remains viable and infectious, each of these proteins can be selectively deleted, substituted or rearranged, in whole or in part, alone or in combination with other desired modifications, to achieve novel deletion or knock out mutants. For example, one or more of the C, D, and/or V genes may be deleted in whole or in part, or its expression reduced or ablated (e.g., by introduction of a stop codon, by a mutation in an RNA editing site, by a mutation that alters the amino acid specified by an initiation codon, or by a frame shift mutation in the targeted ORF(s). In one embodiment, a mutation can be made in the editing site that prevents editing and ablates expression of proteins whose mRNA is generated by RNA editing (Kato et al., EMBO J. 16:578-587, 1997a and Schneider et al., Virology 227:314-322, 1997, each incorporated herein by reference). Alternatively, one or more of the C, D, and/or V ORF(s) can be deleted in whole or in part to alter the phenotype of the resultant recombinant clone to improve growth, attenuation, immunogenicity or other desired phenotypic characteristics (see, U.S. patent application Ser. No. 09/350,821, filed by Durbin et al. on Jul. 9, 1999, incorporated herein by reference).
Alternative nucleotide modifications in human-bovine chimeric PIV of the invention include a deletion, insertion, addition or rearrangement of a cis-acting regulatory sequence for a selected gene in the recombinant genome or antigenome. As with other such modifications described herein, these modifications can be introduced within the human or bovine background genome or antigenome, or may be introduced into the chimeric genome or antigenome by incorporation within the heterologous gene(s) or genome segment(s) added or substituted therein. In one example, a cis-acting regulatory sequence of one PIV gene is changed to correspond to a heterologous regulatory sequence, which may be a counterpart cis-acting regulatory sequence of the same gene in a different PIV, or a cis-acting regulatory sequence of a different PIV gene. For example, a gene end signal may be modified by conversion or substitution to a gene end signal of a different gene in the same PIV strain. In other embodiments, the nucleotide modification may comprise an insertion, deletion, substitution, or rearrangement of a translational start site within the recombinant genome or antigenome, e.g., to ablate an alternative translational start site for a selected form of a protein.
In addition, a variety of other genetic alterations can be produced in a human-bovine chimeric PIV genome or antigenome, alone or together with one or more attenuating mutations adopted from a biologically derived mutant PIV. For example, genes or genome segments from non-PIV sources may be inserted in whole or in part. Alternatively, the order of genes can be changed, or a PIV genome promoter replaced with its antigenome counterpart. Different or additional modifications in the recombinant genome or antigenome can be made to facilitate manipulations, such as the insertion of unique restriction sites in various non-coding regions or elsewhere. Nontranslated gene sequences can be removed to increase capacity for inserting foreign sequences.
In yet additional aspects, polynucleotide molecules or vectors encoding the human-bovine chimeric PIV genome or antigenome can be modified to encode non-PIV sequences, e.g., a cytokine, a T-helper epitope, a restriction site marker, or a protein or immunogenic epitope of a microbial pathogen (e.g., virus, bacterium, parasite, or fungus) capable of eliciting a protective immune response in an intended host. In one such embodiment, human-bovine chimeric PIV are constructed that incorporate a gene or genome segment from a respiratory syncytial virus (RSV), for example a gene encoding an antigenic protein (e.g., an F or G protein), immunogenic domain or epitope of RSV.
In related aspects of the invention, compositions (e.g., isolated polynucleotides and vectors incorporating a PIV-encoding cDNA) and methods are provided for producing an isolated infectious human-bovine chimeric PIV. Included within these aspects of the invention are novel, isolated polynucleotide molecules and vectors incorporating such molecules that comprise a human-bovine chimeric PIV genome or antigenome. Also provided is the same or different expression vector comprising one or more isolated polynucleotide molecules encoding N, P, and L proteins. These proteins also can be expressed directly from the genome or antigenome cDNA. The vector(s) is/are preferably expressed or coexpressed in a cell or cell-free lysate, thereby producing an infectious human-bovine chimeric PIV viral particle or subviral particle.
The above methods and compositions for producing human-bovine chimeric PIV yield infectious viral or subviral particles, or derivatives thereof. A recombinant infectious virus is comparable to the authentic PIV virus particle and is infectious as is. It can directly infect fresh cells. An infectious subviral particle typically is a subcomponent of the virus particle which can initiate an infection under appropriate conditions. For example, a nucleocapsid containing the genomic or antigenomic RNA and the N, P, and L proteins is an example of a subviral particle which can initiate an infection if introduced into the cytoplasm of cells. Subviral particles provided within the invention include viral particles which lack one or more protein(s), protein segment(s), or other viral component(s) not essential for infectivity.
In other embodiments the invention provides a cell or cell-free lysate containing an expression vector which comprises an isolated polynucleotide molecule comprising a human-bovine chimeric PIV genome or antigenome as described above, and an expression vector (the same or different vector) which comprises one or more isolated polynucleotide molecules encoding the N, P, and L proteins of PIV. One or more of these proteins also can be expressed from the genome or antigenome cDNA. Upon expression the genome or antigenome and N, P and L combine to produce an infectious human-bovine chimeric PIV virus or subviral particle.
The human-bovine chimeric PIVs of the invention are useful in various compositions to generate a desired immune response against PIV in a host susceptible to PIV infection. Human-bovine chimeric PIV recombinants are capable of eliciting a protective immune response in an infected mammalian host, yet are sufficiently attenuated so as not to cause unacceptable symptoms of severe respiratory disease in the immunized host. In addition, the human-bovine chimeric PIV recombinants should replicate with sufficient efficiency in vitro to make vaccine preparation feasible. The attenuated virus or subviral particle may be present in a cell culture supernatant, isolated from the culture, or partially or completely purified. The virus may also be lyophilized, and can be combined with a variety of other components for storage or delivery to a host, as desired.
The invention further provides novel vaccines comprising a physiologically acceptable carrier and/or adjuvant and an isolated attenuated human-bovine chimeric PIV virus or subviral particle. In preferred embodiments, the vaccine is comprised of a human-bovine chimeric PIV having at least one, and preferably two or more additional mutations or other nucleotide modifications as described above to achieve a suitable balance of attenuation and immunogenicity. The vaccine can be formulated in a dose of 103 to 107 PFU of attenuated virus. The vaccine may comprise attenuated human-bovine chimeric PIV that elicits an immune response against a single PIV strain or against multiple PIV strains or groups. In this regard, human-bovine chimeric PIV can be combined in vaccine formulations with other PIV vaccine strains, or with other viral vaccine viruses such as RSV.
In related aspects, the invention provides a method for stimulating the immune system to elicit an immune response against PIV in a mammalian subject. The method comprises administering a formulation of an immunologically sufficient amount of a human-bovine chimeric PIV in a physiologically acceptable carrier and/or adjuvant. In one embodiment, the immunogenic composition is a vaccine comprised of a human-bovine chimeric PIV having at least one, and preferably two or more attenuating mutations or other nucleotide modifications specifying a desired phenotype as described above. The vaccine can be formulated in a dose of 103 to 107 PFU of attenuated virus. The vaccine may comprise attenuated human-bovine chimeric PIV virus that elicits an immune response against a single PIV, against multiple PIVs, e.g., HPIV1 and HPIV3, or against one or more PIV(s) and a non-PIV pathogen such as RSV. In this context, human-bovine chimeric PIV can elicit a monospecific immune response or a polyspecific immune response against multiple PIVs, or against one or more PIV(s) and a non-PIV pathogen such as RSV. Alternatively, human-bovine chimeric PIV having different immunogenic characteristics can be combined in a vaccine mixture or administered separately in a coordinated treatment protocol to elicit more effective protection against one PIV, against multiple PIVs, or against one or more PIV(s) and a non-PIV pathogen such as RSV. Preferably the immunogenic composition is administered to the upper respiratory tract, e.g., by spray, droplet or aerosol.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 illustrates cloning of the N coding region of bovine PIV strains Ka or SF into HPIV3. In FIG. 1A-C, the BPIV3 N open reading frame (ORF) replaces its corresponding HPIV3 sequence in the full-length rJS antigenomic cDNA (Durbin et al., 1997a, supra). BPIV3 Ka and SF N genes were first amplified by RT-PCR using standard molecular biological techniques from virion RNA and subcloned as 1.9 kb fragments into pBluescript to give pBS-KaN or pBS-SFN, respectively. The HPIV3 rJS N gene was subcloned as a 1.9 kb Mlul/EcoRI fragment into pUC 119 from a plasmid containing the 5′ half of the rJS HPIV3 antigenome (Durbin et al., 1997a, supra; U.S. patent application Ser. No. 09/083,793, filed May 22, 1998; U.S. Provisional Application No. 60/047,575, filed May 23, 1997 (corresponding to International Publication No. WO 98/53078), and U.S. Provisional Application No. 60/059,385, filed Sep. 19, 1997, each incorporated herein by reference) to give pUC119JSN. Each N gene was modified by site-directed mutagenesis to place an Ncol and AflII site at the translational start and stop sites, respectively. The Ka and SF N genes are identical in the translational start and stop site regions and, therefore, identical mutagenesis reactions were performed on both BPIV3 N genes as depicted in LA. FIG. 1B—Following AflII/Ncol digestion, a 1.5 kb fragment from pBS-KaN or pBS-SFN representing the BPIV3 N coding region was introduced into the Ncol/AflII window of the HPIV3 N subclone pUC119JSN-Ncol/AflII as a replacement for its HPIV3 counterpart. FIG. 1C—Each chimeric subclone was then subjected to site-directed mutagenesis to restore the sequence present in HPIV3 rJS before the translation start codon or after the stop codon and BPIV3 coding sequence immediately after the start codon and before the stop codon. This yielded pUC119B/HKaN and pUC119B/HSFN, which were used to import the BPIV3 N gene into the HPIV3 cDNA clone as shown in FIG. 2. FIG. 1, Panel A, CAAAAATGTTG (SEQ ID NO. 10); GCAACTAATCGA (SEQ ID NO. 11); TAACCATGGTGA (SEQ ID NO. 12); GCACTTAAGCAC (SEQ ID NO. 13). FIG. 1, Panel C, TAACCATGGTGA (SEQ ID NO. 12); GCACTTAAGCAC (SEQ ID NO. 13); CAAAAATGTTGA (SEQ ID NO. 14); GCAACTAGTCGA (SEQ ID NO. 15).
FIG. 2 illustrates insertion of the HPIV3/BPIV3 (strain Ka or SF) chimeric N gene into the HPIV3 antigenomic cDNA. In FIG. 2A, the BPIV3 N ORF of Ka or SF flanked by HPIV3 sequence was subcloned as an Mlul/EcoRI fragment from pUC119B/HKaN or pUC119B/HSFN and inserted into pLeft+2G (Durbin et al., 1997a, supra). The pLeft+2G plasmid contains the 5′ half of the HPIV3 rJS antigenome from nt 1-7437 (genome sense) behind a T7 promoter. The location of two G residues that were inserted between T7 promoter and HPIV3 sequence to improve transcription is indicated by an asterisk. FIG. 2B—An Xhol/NgoMl fragment of pRight (Durbin et al., 1997a, supra; U.S. patent application Ser. No. 09/083,793, filed May 22, 1998; U.S. Provisional Application No. 60/047,575, filed May 23, 1997 (corresponding to International Publication No. WO 98/53078), and U.S. Provisional Application No. 60/059,385, filed Sep. 19, 1997, each incorporated herein by reference) containing the 3′ end of the HPIV3 antigenome-flanked by the hepatitis delta virus ribozyme and T7 terminator was cloned into the Xhol/NgoMl window of the modified pLeft plasmid resulting in plasmids pB/HPIV3KaN and pB/HPIV3SFN. Each of these chimeric constructs contains the complete positive sense sequence of the HPIV3 antigenomic RNA except for the N coding region which has been replaced by its BPIV3 Ka or SF counterpart.
FIG. 3 provides nucleotide sequences of HPIV3, BPIV3 and chimeric viruses of the invention around N translation start (A) and stop (B) codons. The position of the individual ORFs is described in the respective Genbank reports (#AF178654 for BPIV3 Ka, #AF178655 for BPIV3 SF and #Z11515) and included herein by reference. The sequences (positive-sense) flanking the translational start (A) and stop (B) codons (each underlined) in the N gene are shown for the parental recombinant HPIV3 JS (rJS), the parental biologically-derived BPIV3 Ka and SF viruses (Ka and SF), and the chimeric cKa and cSF viruses. Host-specific residues in the cKa and cSF virus sequences and their counterparts in rJS (before the start codon and after the stop codon) and SF or Ka (start codon through stop codon, inclusive) are in boldface type. Plaque-purified chimeric virus was amplified by RT-PCR from virion RNA and sequenced using the Taq Dye Deoxy Terminator Cycle kit (ABI, Foster City, Calif.). This confirmed that the predicted sequences were present in each chimeric virus. FIG. 3A. rJS, GGAACTCTATAATTTCAAAAATGTTGAGCCTATTTGATAC (SEQ ID NO. 16). FIG. 3A. cKa and cSF, GGAACTCTATAATTTCAAAAATGTTGAGTCTATTCGACAC (SEQ ID NO. 17). FIG. 3A. Ka and SF, GAAATCCTAAGACTGTAATCATGTTGAGTCTATTCGACAC (SEQ ID NO. 18). FIG. 3B. rJS, TTAACGCATTTGGAAGCAACTAATCGAATCAACATTTTAA (SEQ ID NO. 19). FIG. 3B. cKa and cSF, TCAGTGCATTCGGAAGCAACTAGTCGAATCAACATTTTAA (SEQ ID NO. 20). FIG. 3B. Ka and SF, TCAGTGCATTCGGAAGCAACTAGTCACAAAGAGATGACCA (SEQ ID NO. 21).
FIG. 4 details the structure of the BPIV3/HPIV3 chimeric viruses of the invention, and their confirmation by TaqI digestion of RT-PCR products generated from virus RNA. In FIG. 4A the genomes of the chimeric cKa and cSF viruses are shown schematically (not to scale) relative to that of HPIV3 and BPIV3 parent viruses. Ka- and SF-specific regions are indicated by light and dark shading respectively. Arrows above the rJS genome indicate the locations of primers used for RT-PCR amplification of chimeric and parent viruses for the purposes of diagnostic TaqI digestion. These primers were directed to regions conserved between HPIV3 and BPIV3 so that they could be used for the amplification of HPIV3, BPIV3 and chimeric BPIV3/HPIV3 viruses. In FIG. 4B the expected sizes of TaqI digestion products for each virus are shown for a 1898-bp PCR product amplified from RNA with the primer pair illustrated in FIG. 4A. This PCR product is illustrated at the top in FIG. 4B, and the N ORF is indicated as a filled rectangle. TaqI fragments unique to each virus and which therefore serve in virus identification are indicated with an asterisk. FIG. 4C provides TaqI profiles of PCR products containing the PIV3 N coding region of chimeric cKa (left) or cSF (right) flanked by those of the HPIV3 and BPIV3 parent viruses. Unique TaqI fragments diagnostic of virus identity and corresponding to those identified in (4B) are indicated with an asterisk. Calculated lengths (bp) of DNA gel bands are indicated.
FIG. 5 provides multicycle growth curves of parental and chimeric viruses in MDBK (A) or LLC-MK2 (B) cells. Monolayers of bovine MDBK (A) or simian LLC-MK2 (B) cells in wells (9.6 cm2 each) of a 6 well plate were infected individually at a multiplicity of infection of 0.01 with the indicated parental or chimeric virus. Three replicate infections were performed for each virus. Samples were taken at the indicated time points, stored at −70° C., and titered by TCID50 assay in parallel. Growth curves are constructed using the average of 3 replicate samples at each time point. The lower limit of virus detectability was 101.5TCID50/ml, which is indicated by a dotted line.
FIGS. 6A-6G set forth the complete positive sense nucleotide sequence (SEQ ID NO. 22) of the bovine PIV3 Ka strain.
FIGS. 7A-7G set forth the complete positive sense nucleotide sequence (SEQ ID NO. 23) of the bovine PIV3 SF stain.
FIG. 8A provides a schematic depiction of the genomes of chimeric rHPIV3-FBHNB and rBPIV3-FHHNH viruses, and of their parent viruses, rHPIV3 JS and BPIV3 Ka (not to scale). The F and HN genes were exchanged in a single restriction fragment between rHPIV3 and rBPIV3 using SgrAI and BsiWI sites that had been introduced in front of the M and HN gene end sequences, respectively.
FIG. 8B depicts assembly of an antigenomic cDNA for BPIV3 Ka. A full length cDNA was constructed to encode the complete antigenomic sequence of BPIV3 Ka (GenBank accession #AF178654). The cDNA was assembled from subclones derived from reverse transcription (RT) of viral (v)RNA and polymerase chain reaction (PCR) amplification. Multiple subclones of the antigenome were sequenced, and only clones matching the consensus sequence of BPIV3 Ka were used for assembly of the full length clone, with the exception of nt 21 and nt 23, which differ from the published sequence but occur with similar frequency in the virus population.
FIG. 8C illustrates features of parental and chimeric bovine-human PIV genomes. The genomes of the chimeric rHPIV3 FBHNB and rBPIV3 FHHNH viruses and those of their parent viruses rHPIV3 JS and BPIV3 Ka are shown schematically (not to scale). Two unique restriction enzyme recognition sites, SgrAI and BsiWI, were introduced near the M and HN gene ends, respectively. The recombinant HPIV3 and BPIV3 viruses bearing these introduced restriction sites were designeated rHPIV3s and rBPIV3s as indicated in Fugure 8C2. Glycoprotein genes were exchanged between rHPIV3 JS and rBPIV3 Ka. The nucleotide sequence that was mutagenized is shown below each cDNA construct, with the position of the first nucleotide of each sequence indicated. The introduced SgrAI and BsiWI restriction sites are underlined and nucleotides that differ between HPIV3 and BPIV3 and thus identify the origin of the gene inserts are depicted in bold print. FIG. 8C, Panel 1, rHPIV 3 JS, TCCACCGGTGCA (SEQ ID NO. 4), TAGACAAAAGGG (SEQ ID NO. 24). FIG. 8C, Panel 1. rBPIV3 Ka, TCCAACATTGCA (SEQ ID NO. 2); AAGATATAAAGA (SEQ ID NO. 25). FIG. 8C, Panel 2 rHPIV3s, CGCACCGGTGTA (SEQ ID NO. 5); TAGACGTACGGG (SEQ ID NO. 26). FIG. 8C, Panel 2. rBPIV3s, TCCACCGGTGCA (SEQ ID NO. 3); AAGACGTACGGA (SEQ ID NO. 27). FIG. 8C, Panel 3. rHPIV3 FBHNB, CGCACCGGTGCA (SEQ ID NO. 28); AAGACGTACGGG (SEQ ID NO. 29). FIG. 8C, Panel 3. rBPIV3 FHHNH, AAGACGTACGGG (SEQ ID NO. 30); TAGACGTACGGA (SEQ ID NO. 31).
FIG. 9 provides a confirmation of the identity of recombinant viruses by RT-PCR of viral RNA and Eco RI digestion. RT-PCR products of viral RNA were prepared with a primer pair that recognized conserved regions on either side of the F and HN genes in both BPIV3 and HPIV3. Digestion with Eco RI resulted in a unique pattern of restriction fragments for each of the four viruses. In the schematic diagram on the left, horizontal lines symbolize the amplified viral sequences and vertical bars show the positions of Eco RI sites. The expected size of each restriction fragment is indicated above the line. The numbers below each line correspond to the sequence position in the antigenomic RNA of BPIV3 Ka, HPIV3 JS (GenBank accession #AF178654 and Z11575), or of the indicated chimeric derivative. On the right, a 1% agarose gel of the Eco RI digestion of PCR products is shown, confirming the identity of parental and chimeric viruses. The asterisks indicate gel bands that contain two restriction fragments that comigrate due to close similarity in size.
FIG. 10 depicts multicycle replication of chimeric and parental viruses in simian LLC-MK2 cells. Multicycle replication (the input inoculum had an MOI of 0.01) of the three chimeric viruses rHPIV3-FBHNB, rBPIV3-FHHNH and rHPIV3-NB (also referred to as cKa) is compared with the replication of their parental viruses BPIV3 Ka and rBPIV3. The virus titers are shown as mean log10 TCID50/ml±standard error of triplicate samples. The lower limit of detection of this assay is 10 TCID50, as indicated by the dotted horizontal line.
FIG. 11 documents mean titers of chimeric and parental viruses in nasopharyngeal swabs of infected rhesus monkeys over the course of infection. Virus titers are shown as mean TCID50/ml in LLC-MK2 cells±standard error for groups of 4 or 6 monkeys infected with the same virus. This illustrates the same experiment as shown in Table 3. In panel A, mean titers of rHPIV3-FBHNB are compared to rHPIV3 and BPIV3 Ka titers. In panel B, mean rBPIV3-FHHNH titers are compared to those of BPIV3 Ka and rHPIV3, which, for the last two viruses, are the same values in panel A but are presented separately to facilitate comparison. Day 5 titers were excluded from the FIGS. because they were much lower than day 4 and day 6 titers, most likely due to technical problems during the sample collection.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
The present invention provides recombinant parainfluenza virus (PIV) cloned as a chimera of human and bovine PIV genomic or antigenomic sequences to yield a human-bovine chimeric PIV. The chimeric construction of human-bovine PIV yields a viral particle or subviral particle that is infectious in mammals, particularly humans, and useful for generating immunogenic compositions for clinical or veterinary use. Also provided within the invention are novel methods and compositions for designing and producing attenuated, human-bovine chimeric PIV, as well as methods and compositions for the prophylaxis and treatment of PIV infection.
Chimeric human-bovine PIV of the invention are recombinantly engineered to incorporate nucleotide sequences from both human and bovine PIV strains to produce an infectious, chimeric virus or subviral particle. In this manner, candidate vaccine viruses are recombinantly engineered to elicit an immune response against PIV in a mammalian host susceptible to PIV infection, including humans and non-human primates. Human-bovine chimeric PIV according to the invention may elicit an immune response to a specific PIV, e.g., HPIV3, or a polyspecific response against multiple PIVs, e.g., HPIV1 and HPIV3.
Exemplary human-bovine chimeric PIV of the invention incorporate a chimeric PIV genome or antigenome comprising both human and bovine polynucleotide sequences, as well as a major nucleocapsid (N) protein, a nucleocapsid phosphoprotein (P), and a large polymerase protein (L). Additional PIV proteins may be included in various combinations to provide a range of infectious subviral particles, up to a complete viral particle or a viral particle containing supernumerary proteins, antigenic determinants or other additional components.
Chimeric human-bovine PIV of the invention include a partial or complete “background” PIV genome or antigenome derived from or patterned after a human or bovine PIV strain or serotype virus combined with one or more heterologous gene(s) or genome segment(s) of a different PIV strain or serotype virus to form the human-bovine chimeric PIV genome or antigenome. In certain aspects of the invention, chimeric PIV incorporate a partial or complete human PIV (HPIV) background genome or antigenome combined with one or more heterologous gene(s) or genome segment(s) from a bovine PIV. In alternate aspects of the invention, chimeric PIV incorporate a partial or complete bovine PIV (BPIV) background genome or antigenome combined with one or more heterologous gene(s) or genome segment(s) from a human PIV.
The partial or complete background genome or antigenome typically acts as a recipient backbone or vector into which are imported heterologous genes or genome segments of the counterpart, human or bovine PIV. Heterologous genes or genome segments from the counterpart, human or bovine PIV represent “donor” genes or polynucleotides that are combined with, or substituted within, the background genome or antigenome to yield a human-bovine chimeric PIV that exhibits novel phenotypic characteristics compared to one or both of the contributing PIVs. For example, addition or substitution of heterologous genes or genome segments within a selected recipient PIV strain may result in an increase or decrease in attenuation, growth changes, altered immunogenicity, or other desired phenotypic changes as compared with a corresponding phenotype(s) of the unmodified recipient and/or donor. Genes and genome segments that may be selected for use as heterologous inserts or additions within human-bovine chimeric PIV of the invention include genes or genome segments encoding a PIV N, P, C, D, V, M, SH, where applicable, F, HN and/or L protein(s) or portion(s) thereof. Regulatory regions, such as the extragenic leader or trailer or intergenic regions, are also useful as heterologous inserts or additions.
The heterologous gene(s) or genome segment(s) may be added or substituted at a position corresponding to a wild-type gene order position of the counterpart gene(s) or genome segment(s) within the partial or complete PIV background genome or antigenome, which counterpart gene or genome segment is thereby replaced or displaced (e.g., to a more promotor-distal position). In yet additional embodiments, the heterologous gene or genome segment is added or substituted at a position that is more promoter-proximal or promotor-distal compared to a wild-type gene order position of the counterpart gene or genome segment within the background genome or antigenome, which enhances or reduces, respectively, expression of the heterologous gene or genome segment.
The introduction of heterologous immunogenic proteins, domains and epitopes to produce human-bovine chimeric PIV is particularly useful to generate novel immune responses in an immunized host. Addition or substitution of an immunogenic gene or genome segment from one, donor PIV within a recipient genome or antigenome of a different PIV can generate an immune response directed against the donor subgroup or strain, the recipient subgroup or strain, or against both the donor and recipient subgroup or strain. To achieve this purpose, human-bovine chimeric PIV may also be constructed that express a chimeric protein, e.g., an immunogenic glycoprotein having a cytoplasmic tail and/or transmembrane domain specific to one PIV fused to an ectodomain of a different PIV to provide, e.g., a human-bovine fusion protein, or a fusion protein incorporating domains from two different human PIVs. In a preferred embodiment, a human-bovine chimeric PIV genome or antigenome encodes a chimeric glycoprotein in the recombinant virus or subviral particle having both human and bovine glycoprotein domains or immunogenic epitopes. For example, a heterologous genome segment encoding a glycoprotein ectodomain from a human PIV HN or F glycoprotein may be joined with a polynucleotide sequence (i.e., a genome segment) encoding the corresponding bovine HN or F glycoprotein cytoplasmic and transmembrane domains to form the human-bovine chimeric PIV genome or antigenome.
In other embodiments, human-bovine chimeric PIV useful in a vaccine formulation can be conveniently modified to accommodate antigenic drift in circulating virus. Typically the modification will be in the HN and/or F proteins. This might involve the introduction of one or more point mutations; it might also involve an entire HN or F gene, or a genome segment encoding a particular immunogenic region thereof, from one PIV strain or group is incorporated into a chimeric PIV genome or antigenome cDNA by replacement of a corresponding region in a recipient clone of a different PIV strain or group, or by adding one or more copies of the gene, such that multiple antigenic forms are represented. Progeny virus produced from the modified PIV clone can then be used in vaccination protocols against emerging PIV strains.
Replacement of a human PIV coding sequence or non-coding sequence (e.g., a promoter, gene-end, gene-start, intergenic or other cis-acting element) with a heterologous counterpart yields chimeric PIV having a variety of possible attenuating and other phenotypic effects. In particular, host range and other desired effects arise from substituting a bovine or murine PIV (MPIV) protein, protein domain, gene or genome segment imported within a human PIV background, wherein the bovine or murine gene does not function efficiently in a human cell, e.g., from incompatibility of the g heterologous sequence or protein with a biologically interactive human PIV sequence or protein (i.e., a sequence or protein that ordinarily cooperates with the substituted sequence or protein for viral transcription, translation, assembly, etc.) or, more typically in a host range restriction, with a cellular protein or some other aspect of the cellular milieu which is different between the permissive and less permissive host. In exemplary embodiments, bovine PIV sequences are selected for introduction into human PIV based on known aspects of bovine and human PIV structure and function.
HPIV3 is a member of the Respirovirus genus of the Paramyxoviridae family in the order Mononegavirales (Collins et al., 1996, supra). HPIV3 is the best characterized of the HPIVs and represents the prototype HPIV. Its genome is a single strand of negative-sense RNA 15462 nucleotides (nt) in length (Galinski et al., Virology 165:499-510, 1988; and Stokes et al., Virus Res. 25:91-103, 1992; each incorporated herein by reference). At least eight proteins are encoded by the PIV3 genome: the nucleocapsid protein N, the phosphoprotein P, the C and D proteins of unknown functions, the matrix protein M, the fusion glycoprotein F, the hemagglutinin-neuraminidase glycoprotein HN, and the large polymerase protein L (Collins et al., 1996, supra). A protein containing the V ORF in the P gene might also be produced (Durbin et al., Virology 261:319-333,1999)
The M, HN, and F proteins are envelope-associated, and the latter two are surface glycoproteins which, as is the case with each PIV, are the major neutralization and protective antigens (Collins et al., 1996, supra). The significant sequence divergence between comparable PIV HN or F proteins among the PIVs is thought to be the basis for the type specificity of the protective immunity (Collins et al., 1996, supra; Cook et al., Amer. Jour. Hyg. 77:150-159, 1963; Ray et al., J. Infect. Dis. 162:746-749, 1990; each incorporated herein by reference).
The HPIV3 genes are each transcribed as a single mRNA that encodes a single protein, with the exception of the P mRNA which contains four ORFs, namely P, C, D and V (Galinski et al., Virology 186:543-550, 1992; and Spriggs et al., J. Gen. Virol. 67:2705-2719, 1986; each incorporated herein by reference). The P and C proteins are translated from separate, overlapping ORFs in the mRNA. Whereas all paramyxoviruses encode a P protein, only members of the genus Respirovirus and Morbillivirus encode a C protein. Individual viruses vary in the number of proteins expressed from the C ORF and in its importance in replication of the virus in vitro and in vivo. Sendai virus (SeV) expresses four independently initiated proteins from the C ORF: C′, C, Y1, and Y2, whose translational start sites appear in that order in the mRNA (Cumin, et al., Enzyme 44:244-249,1990; Lamb et al., in The Paramyxoviruses. D. Kingsbury, ed., pp. 181-214, Plenum Press, New York, 1991; incorporated herein by reference), whereas HPIV3 and measles virus (MeV) express only a single C protein (Bellini et al., J. Virol. 53:908-919, 1985; Sanchez et al., Virology 147:177-86, 1985; and Spriggs et al., 1986, supra; each incorporated herein by reference).
The PIV3 D protein is a fusion protein of the P and D ORFs, and is expressed from the P gene by the process of co-transcriptional RNA editing in which two nontemplated G residues are added to the P mRNA at the RNA editing site (Galinski et al., 1992, supra; and Pelet et al., EMBO J. 10:443-448, 1991; each incorporated herein by reference). BPIV3, the only other paramyxovirus which expresses a D protein, uses RNA editing to express this protein as well as a second protein, the V protein.
Nearly all members of the genera Respirovirus, Rubulavirus, and Morbillivirus express a V protein. The one member which clearly does not is HPIV1, which lacks an intact V ORF (Matsuoka et al., J. Virol. 65:3406-3410, 1991, incorporated herein by reference). The V ORF is characterized by the presence of a cysteine-rich domain that is-highly conserved (Cattaneo et al., Cell 56:759-764, 1989; Park et al., J. Virol. 66:7033-7039, 1992; Thomas et al., Cell 54:891-902, 1988; and Vidal et al., J. Virol. 64:239-246, 1990; each incorporated herein by reference). The V ORF is maintained in each of the HPIV3 viruses sequenced to date suggesting that this ORF is expressed and retains function for this virus (Galinski et al., Virology 155:46-60, 1986; Spriggs et al., 1986, supra; and Stokes et al., 1992, supra; incorporated herein by reference).
The BPIV3 V protein is expressed when one nontemplated G residue is added at the RNA editing site (Pelet et al., 1991, supra; incorporated herein by reference). However, in the case of HPIV3, two translation stop codons lie between the editing site and the V ORF, and it is not clear whether HPIV3 represents another example in which this ORF is not expressed, or whether it is expressed by some other mechanism. One possibility is that HPIV3 editing also occurs at a second, downstream site in the P gene, although this did not appear to occur in cell culture (Galinski et al., 1992, supra). Alternatively, it might be that ribosomes gain access to the V ORF by ribosomal frameshifting. This would be comparable to the situation with the P locus of MV. MV expresses C, P, and V proteins, but also expresses a novel R protein which is synthesized by frameshifting from the P ORF to the V ORF (Liston et al., J. Virol. 69:6742-6750, 1995, incorporated herein by reference). Genetic evidence suggests that the V ORF of HPIV3 is functional (Durbin et al., 1999, supra).
Although the means by which HPIV3 expresses its V protein is unclear, the extreme conservation of the its V ORF in different strains suggests that it is indeed expressed. The function of the V protein is not well defined, but V-minus MV and SeV recombinants have been recovered that replicate efficiently in vitro but exhibit reduced replication in vivo (Delenda, et al., Virology 228:55-62, 1997; Delenda et al., Virology 242:327-337, 1998; Kato et al., 1997a, supra; Kato et al., J. Virol. 71:7266-7272, 1997b; and Valsamakis et al., J. Virol. 72:7754-7761, 1998; each incorporated herein by reference).
The viral genome of PIV also contains extragenic leader and trailer regions, possessing all or part of the promoters required for viral replication and transcription, as well as non-coding and intergenic regions. Thus, the PIV genetic map is represented as 3′ leader-N-P/C/D/V-M-F-HN-L-5′ trailer. Some viruses, such as simian virus 5 and mumps virus, have a gene located between F and HN that encodes a small hydrophobic (SH) protein of unknown function. Transcription initiates at the 3′ end and proceeds by a sequential stop-start mechanism that is guided by short conserved motifs found at the gene boundaries. The upstream end of each gene contains a gene-start (GS) signal, which directs initiation of its respective mRNA. The downstream terminus of each gene contains a gene-end (GE) motif which directs polyadenylation and termination. Exemplary sequences have been described for the human PIV3 strains JS (GenBank accession number Z11575, incorporated herein by reference) and Washington (Galinski M. S., in The Paramyxoviruses, Kingsbury, D. W., ed., pp. 537-568, Plenum Press, New York, 1991, incorporated herein by reference), and for the bovine PIV3 strain 910N (GenBank accession number D80487, incorporated herein by reference).
As used herein, “PIV gene” generally refers to a portion of the PIV genome encoding an mRNA and typically begins at the upstream end with a gene-start (GS) signal and ends at the downstream end with the gene-end (GE) signal. The term PIV gene also includes what is described as “translational open reading frame”, or ORF, particularly in the case where a protein, such as C, is expressed from an additional ORF rather than from a unique mRNA. To construct human-bovine chimeric PIV of the invention, one or more PIV gene(s) or genome segment(s) may be deleted, inserted or substituted in whole or in part. This means that partial or complete deletions, insertions and substitutions may include open reading frames and/or cis-acting regulatory sequences of any one or more of the PIV genes or genome segments. By “genome segment” is meant any length of continuous nucleotides from the PIV genome, which might be part of an ORF, a gene, or an extragenic region, or a combination thereof.
The instant invention involves a method for developing live attenuated PIV vaccine candidates based on chimeras between HPIVs and BPIV3. Chimeras are constructed through a cDNA-based virus recovery system. Recombinant viruses made from cDNA replicate independently and are propagated in the same manner as if they were biologically-derived viruses. Preferred human-bovine chimeric PIV vaccine candidates of the invention bear one or more of the major antigenic determinants of one or more human PIV(s), e.g., HPIV1, HPIV2, and/or HPIV3, in a background which is attenuated by the substitution or addition of one or more BPIV genes or genome segments. The major protective antigens of PIVs are their HN and F glycoproteins, although other proteins can also contribute to a protective immune response.
Thus, the invention provides a new basis for attenuating a wild type or mutant parental virus for use as a vaccine against PIV, one which is based on host range effects due to the introduction of one or more gene(s) or genome segment(s) between HPIV and BPIV. There are numerous nucleotide and amino acid sequence differences between BPIV and HPIV, which are reflected in host range differences. For example, between HPIV3 and BPIV3 the percent amino acid identity for each of the following proteins is: N (86%), P (65%), M (93%), F (83%), HN (77%), and L (91%). The host range difference is exemplified by the highly permissive growth of HPIV3 in rhesus monkeys, compared to the restricted replication of two different strains of BPIV3 in the same animal (van Wyke Coelingh et al., 1988, supra). Although the basis of the host range differences between HPIV3 and BPIV3 remains to be deterrnined, it is likely that they will involve more than one gene and multiple amino acid differences. The involvement of multiple genes and possibly cis-acting regulatory sequences, each involving multiple amino acid or nucleotide differences, gives a very broad basis for attenuation, one which cannot readily be altered by reversion. This is in contrast to the situation with other live attenuated HPIV3 viruses which are attenuated by one or several point mutations. In this case, reversion of any individual mutation may yield a significant reacquisition of virulence or, in a case where only a single residue specified attenuation, complete reacquisition of virulence.
In exemplary embodiments of the invention described hereinbelow, the background genome or antigenome is an HPIV3 genome or antigenome, and the heterologous gene or genome segment is a N ORF derived from, alternatively, a Ka or SF strain of BPIV3 (which are 99% related in amino acid sequence). The N ORF of the HPIV3 background antigenome is substituted by the counterpart BPIV3 N ORF yielding a novel recombinant human-bovine chimeric PIV cDNA clone. Replacement of the HPIV3 N ORF of HPIV3 with that of BPIV3 Ka or SF results in a protein with approximately 70 amino acid differences (depending on the strain involved) from that of HPIV3 N. N is one of the more conserved proteins, and substitution of other proteins such as P, singly or in combination, would result in many more amino acid differences. The involvement of multiple genes and genome segments each conferring multiple amino acid or nucleotide differences provides a broad basis for attenuation which is highly stable to reversion.
This mode of attenuation contrasts sharply to current HPIV vaccine candidates that are attenuated by one or more point mutations, where reversion of an individual mutation may yield a significant or complete reacquisition of virulence. In addition, several known attenuating point mutations in HPIV typically yield a temperature sensitive phenotype. One problem with attenuation associated with temperature sensitivity is that the virus can be overly restricted for replication in the lower respiratory tract while being under attenuated in the upper respiratory tract. This is because there is a temperature gradient within the respiratory tract, with temperature being higher (and more restrictive) in the lower respiratory tract and lower (less restrictive) in the upper respiratory tract. The ability of an attenuated virus to replicate in the upper respiratory tract can result in complications including congestion, rhinitis, fever and otitis media, whereas overattenuation in the lower respiratory tract can reduce immunogenicity. Thus, attenuation achieved solely by temperature sensitive mutations may not be ideal. In contrast, host range mutations present in human-bovine chimeric PIV of the invention will not in most cases confer temperature sensitivity. Therefore, the novel method of PIV attenuation provided by the invention will be more stable genetically and phenotypically and less likely to be associated with residual virulence in the upper respiratory tract compared to other known PIV vaccine candidates.
Surprisingly, both the Ka and SF HPIV3/BPIV3 chimeric recombinants involving the N ORF replacement were viable. Since the N protein of Ka or SF strain BPIV3 differs in 70 of 515 amino acid residues, respectively, from that of the JS strain of HPIV3. It was therefore unexpected that a bovine N protein with this level of amino acid sequence divergence could efficiently interact with the HPIV3 RNA, or with other HPIV3 proteins that constitute the functional replicase/transcriptase. Equally surprising was the finding that the Ka and SF chimeric viruses replicated as efficiently in cell culture as either HPIV3 or BPIV3 parent indicating that the chimeric recombinants did not exhibit gene incompatibilities that restricted replication in vitro. This property of efficient replication in vitro is important since it permits efficient manufacture of this biological.
Also surprising is the observation, based on the studies hereinbelow, that the Ka and the SF HPIV3/BPIV3 chimeric recombinants (termed cKa and cSF), bearing only one bovine gene, are nearly equivalent to their BPIV3 parents in the degree of host range restriction in the respiratory tract of the rhesus monkey. In particular, the cKa and cSF viruses exhibited approximately a 60-fold or 30-fold reduction, respectively, in replication in the upper respiratory tract of rhesus monkeys compared to replication of HPIV3. Based on this finding, it is possible that other BPIV3 genes will also confer desired levels of host range restriction within human-bovine chimeric PIV of the invention. Thus, according to the methods herein, a list of attenuating determinants will be readily identified in heterologous genes and genome segments of both HPIV and BPIV that will confer, in appropriate combination, an optimal level of host range restriction and immunogenicity on human-bovine chimeric PIV selected for vaccine use. In preferred vaccine recombinants, attenuation marked by replication in the lower and/or upper respiratory tract in an accepted animal model for PIV replication in humans, e.g., hamsters or rhesus monkeys, may be reduced by at least about two-fold, more often about 5-fold, 10-fold, or 20-fold, and preferably 50-100-fold and up to 1,000-fold or greater overall (e.g., as measured between 3-8 days following infection) compared to growth of the corresponding wild-type or mutant parental PIV strain.
Confirming the unexpected nature and advantages provided by the human-bovine chimeric PIV of the invention, both the cKa and cSF induced a high level of protection against HPIV3 challenge in the respiratory tract of rhesus monkeys, despite the exceptional degree of restriction of replication exhibited by these viruses in this model for human PIV infection and protection. In particular, previous infection with either chimeric virus induced a high level of resistance to replication of the rJS challenge virus in both the upper and lower respiratory tract. Infection of monkeys with cKa elicited a high degree of protection as indicated by an approximate 300-fold reduction of replication of wild type HPIV3 (rJS) in the upper respiratory tract, and an approximate 1000-fold reduction in the lower tract compared to uninoculated control monkeys. Monkeys infected with cSF manifested a 2000-fold reduction of replication of rJS in the upper respiratory tract, and a 1000-fold reduction in the lower tract compared to uninoculated control monkeys. The levels of protection elicited by cKa or cSF were comparable to those seen in monkeys previously infected with either the bovine or the human PIV parent. Thus, infection with human-bovine chimeric PIV of the invention provides a high level of protection in the upper and lower respiratory tract of monkeys, and both chimeric viruses represent promising vaccine candidates. In other preferred vaccine recombinants, the immunogenic activity of human-bovine chimeric PIV will be balanced against the level of attenuation to achieve useful vaccine candidates, and will typically be marked by a reduction of replication of challenge virus, e.g., rJS in the lower and/or upper respiratory tract by about 50-100-fold, 100-500-fold, preferably about 500-2,000-fold and up to 3,000-fold or greater overall (e.g., as measured between 3-8 days post-challenge). Thus, the recombinant vaccine viruses of the invention maintain immunogenicity while exhibiting concomitant reductions in replication and growth. This surprising assemblage of phenotypic traits is highly desired for vaccine development.
The observation that the N gene from two independent strains of BPIV3 confers an attenuation phenotype on HPIV3 for the rhesus monkey indicates that this is likely a property shared by N genes of other BPIV strains. Accordingly, within the methods of the invention any BPIV gene or genome segment, singly or in combination with one or more other BPIV gene(s) or genome segment(s), can be combined with HPIV sequences to produce an attenuated HPIV3/BPIV3 chimeric recombinant virus suitable for use as a vaccine virus. In preferred embodiments, all HPIVs, including HPIV1, HPIV2, HPIV3. and variant strains thereof, are useful recipients for attenuating BPIV gene(s) and/or genome segment(s). In general, the HPIV genes selected for inclusion in a HPIV3/BPIV3 chimeric virus will include one or more of the protective antigens, such as the HN or F glycoproteins.
Alternative human-bovine chimeric PIV of the invention will contain protective antigenic determinants of HPIV1 or HPIV2. This may be achieved, for example, by expression of an HN and/or F gene of HPIV1 or HPIV2 as an extra gene(s) in an attenuated HPIV3/BPIV3 chimeric recombinant. Alternatively, it is possible to use a HPIV3/HPIV1 or a HPIV3/HPIV2 antigenic chimeric virus, in which the HPIV1 or HPIV2 HN and/or F genes replace their PIV3 counterpart(s) (Skiadopoulos et al., 1999a, supra; Tao et al., 1999, supra; and U.S. patent application Ser. No. 09/083,793, filed May 22, 1998; each incorporated herein by reference), as a recipient or background virus for one or more heterologous, attenuating bovine gene(s) or genome segment(s), for example a Ka or SF N gene or genome segment. Such antigenic chimeric viruses will be attenuated by the bovine N gene, but will induce immunity to the HPIV1 or HPIV2 virus. In this context, a chimeric PIV1 vaccine candidate has been generated using the PIV3 cDNA rescue system by replacing the PIV3 HN and F open reading frames (ORFs) with those of PIV1 in a PIV3 full-length cDNA that contains the three attenuating mutations in L. The recombinant chimeric virus derived from this cDNA is designated rPIV3-1.cp45L (Skiadopoulos et al., 1998, supra; Tao et al., 1998, supra; Tao et al., 1999, supra). rPIV3-1.cp45L was attenuated in hamsters and induced a high level of resistance to challenge with PIV1. A recombinant chimeric virus, designated rPIV3-1cp45, has also been produced that contains 12 of the 15 cp45 mutations, i.e., excluding the mutations in HN and F, and is highly attenuated in the upper and lower respiratory tract of hamsters (Skiadopoulos et al., 1999a, supra).

The remainder of this text has been abbreviated because it is either very complex or very long and may not be displayed properly or efficiently by your web browser. Even with this precaution, certain browsers may display odd behaviors when rendering this document. Please download the document to view it in its entirety.
(Source: USPTO)
What is claimed:
1. An isolated infectious human-bovine chimeric parainfluenza virus (PIV) comprising a major nucleocapsid (N) protein, a nucleocapsid phosphoprotein (P), a large polymerase protein (L), and a partial or complete PIV background genome or antigenome of a human PIV (HPIV) or bovine PIV (BPIV) combined with one or more heterologous gene(s) or genome segment(s) of a different PIV to form a human-bovine chimeric PIV genome or antigenome, wherein at least one of said heterologous gene(s) or genome segment(s) encodes an N protein of a BPIV3.
2. The chimeric PIV of claim 1, wherein said chimeric genome or antigenome further incorporates a heterologous genome segment integrated into the background genome or antigenome to form a chimeric gene that encodes a chimeric glycoprotein.
3. The chimeric PIV of claim 1, wherein a heterologous gene or genome segment is substituted for a counterpart gene or genome segment in a partial PIV background genome or antigenome.
4. The chimeric PIV of claim 1, wherein the chimeric genome or antigenome comprises a partial or complete BPIV background genome or antigenome combined with one or more heterologous gene(s) or genome segment(s) from a human PIV.
5. The chimeric PIV of claim 4, wherein one or more HPIV glycoprotein genes selected from HN and F, or one or more genome segments encoding a cytoplasmic domain, transmembrane domain, ectodomain or immunogenic epitope thereof, is/are substituted for one or more counterpart genes or genome segments within the BPIV background genome or antigenome.
6. The chimeric PIV of claim 4, wherein one or more HPIV glycoprotein genes selected from HN and F is/are substituted to replace one or more counterpart glycoprotein genes in the BPIV background genome or antigenome.
7. The chimeric PIV of claim 6, wherein both HPIV glycoprotein genes HN and F are substituted to replace counterpart HN and F glycoprotein genes in the BPIV background genome or antigenome.
8. The chimeric PIV of claim 4, wherein the human-bovine chimeric PIV genome or antigenome encodes a chimeric glycoprotein having a HPIV glycoprotein ectodomain, antigenic determinant or immunogenic epitope.
9. The chimeric PIV of claim 8, wherein the heterologous genome segment encodes a glycoprotein ectodomain.
10. The chimeric PIV of claim 4, wherein one or more HPIV glycoprotein genes HN and F, or a genome segment encoding a cytoplasmic domain, transmembrane domain, ectodomain or immunogenic epitope thereof is added to or incorporated within a BPIV background genome or antigenome.
11. The chimeric PIV of claim 4, wherein the chimeric genome or antigenome is further modified by addition or substitution of one or more additional heterologous gene(s) or genome segment(s) from a human PIV within the partial or complete bovine background genome or antigenome to increase genetic stability or alter attenuation, reactogenicity or growth in culture of the chimeric virus.
12. The chimeric PIV of claim 1, wherein the bovine-human chimeric genome or antigenome comprises a partial or complete PIV vector genome or antigenome combined with one or more heterologous genes or genome segments encoding one or more antigenic determinants of one or more heterologous pathogens.
13. The chimeric PIV of claim 12, wherein said one or more antigenic determinant(s) is/are selected from HPIV1, HPIV2 or HPIV3 HN and F glycoproteins and antigenic domains, fragments and epitopes thereof.
14. The chimeric PIV of claim 12, wherein one or more gene(s) or genome segment(s) encoding one or more antigenic determinant(s) of HPIV2 is/are added to or substituted within the partial or complete BPIV vector genome or antigenome.
15. The chimeric PIV of claim 12, wherein a plurality of heterologous genes or genome segments encoding antigenic determinants of multiple HPIVs are added to or incorporated within the partial or complete BPIV vector genome or antigenome.
16. The chimeric PIV of claim 12, wherein the vector genome or antigenome is a partial or complete BPIV genome or antigenome and the heterologous pathogen is selected from measles virus, subgroup A and subgroup B respiratory syncytial viruses, mumps virus, human papilloma viruses, type 1 and type 2 human immunodeficiency viruses, herpes simplex viruses, cytomegalovirus, rabies virus, Epstein Barr virus, filoviruses, bunyaviruses, flaviviruses, alphaviruses and influenza viruses.
17. The chimeric PIV of claim 16, wherein said one or more heterologous antigenic determinant(s) is/are selected from measles virus HA and F proteins, subgroup A or subgroup B respiratory syncytial virus F, G, SH and M2 proteins, mumps virus HN and F proteins, human papilloma virus L1 protein, type 1 or type 2 human immunodeficiency virusgp160 protein, herpes simplex virus and cytomegalovirus gB, gC, gD, gE, gG, gH, gI,gJ, gK, gL, and gM proteins, rabies virus G protein, Epstein Barr Virus gp350 protein; filovirus G protein, bunyavirus G protein, Flavivirus E and NS 1 proteins, and alphavirus E protein, and antigenic domains, fragments and epitopes thereof.
18. The chimeric PIV of claim 16, wherein the heterologous pathogen is measles virus and the heterologous antigenic determinant(s) is/are selected from the measles virus HA and F proteins and antigenic domains, fragments and epitopes thereof.
19. The chimeric PIV of claim 18, wherein a transcription unit comprising an open reading frame (ORF) of a measles virus HA gene is added to or incorporated within a HPIV3 vector genome or antigenome.
20. The chimeric PIV of claim 16, which incorporates a gene or genome segment from respiratory syncytial virus (RSV).
21. The chimeric PIV of claim 20, wherein the gene or genome segment encodes a RSV F and/or G glycoprotein or immunogenic domain(s) or epitope(s) thereof.
(Source: USPTO)